Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31678
Trapped Gene
AC139244.4 (ENSMUSG00000035656)
Vector Insertion
Chr 16: 32736552 - 32750331
Public Clones IST13553A11 (tigm) IST13746G10 (tigm) IST13652C9 (tigm) IST13578B9 (tigm)
IST11381E7 (tigm) IST13781E5 (tigm) IST13652C2 (tigm) IST12163H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644327 (Chr16:32736466..32736551 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAGTTCCCTGGCTGTGTC Chr16:32736483..32736502 59.84 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644327 (Chr16:32736466..32736551 +)
Downstram Exon
ENSMUSE00000619835 (Chr16:32750332..32750857 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAGTTCCCTGGCTGTGTC Chr16:32736483..32736502 59.84 60 GTGGTTTGAGGTTTGCTGGT Chr16:32750502..32750521 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644327 Chr16:32736466..32736551 GAGAGTTCCCTGGCTGTGTC Chr16:32736483..32736502 59.84 60

*** Putative Vector Insertion (Chr 16: 32736552 - 32750331) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000619835 Chr16:32750332..32750857 GTGGTTTGAGGTTTGCTGGT Chr16:32750502..32750521 60.01 50
downstream ENSMUSE00000619834 Chr16:32751173..32752112 TTCTCGCCAGGAGAGTTTGT Chr16:32751687..32751706 59.99 50
downstream ENSMUSE00000619833 Chr16:32752347..32752514 GAGGTGGCTGAAGGATTTGA Chr16:32752380..32752399 60.19 50
downstream ENSMUSE00000619832 Chr16:32754053..32754207 TGAGTGGAGGATGTTGTGGA Chr16:32754140..32754159 60.09 50
downstream ENSMUSE00000619831 Chr16:32754399..32754626 GTTTGAGGATTGGTGCTGGT Chr16:32754505..32754524 59.97 50
downstream ENSMUSE00000619830 Chr16:32755308..32756018 GTGATGTGATGGGTGCTGAC Chr16:32755557..32755576 59.97 55
downstream ENSMUSE00000619829 Chr16:32756337..32756664 TGAACTGCTCATGCTGGAAG Chr16:32756519..32756538 60.14 50
downstream ENSMUSE00000644325 Chr16:32757434..32757562 GGGCTAGTAAGGGTCGAGGA Chr16:32757506..32757525 60.59 60
downstream ENSMUSE00000644324 Chr16:32759271..32759404 CTCCGACTTCAGACCCGTAG Chr16:32759309..32759328 59.86 60
downstream ENSMUSE00000644323 Chr16:32760164..32760328 TAAAATATGGCTCCCCTGGA Chr16:32760327..32760346 59.37 45
downstream ENSMUSE00000644322 Chr16:32761274..32761429 TGGGCAGTATAGGCAGGAAC Chr16:32761419..32761438 60.1 55
downstream ENSMUSE00000619827 Chr16:32762520..32762650 GTGGAGAGGATGGCTTGGTA Chr16:32762551..32762570 60.07 55
downstream ENSMUSE00000619826 Chr16:32763997..32764085 AGGAATCGATCTGGACGGTA Chr16:32764074..32764093 59.51 50
downstream ENSMUSE00000619825 Chr16:32765770..32765949 ACATTTGAGCCGGTAGTTGG Chr16:32765837..32765856 59.99 50
downstream ENSMUSE00000619824 Chr16:32766172..32766288 TTCTCCAGCCTTCTCGAAAC Chr16:32766270..32766289 59.55 50
downstream ENSMUSE00000619823 Chr16:32766971..32767090 ACACAGAACGAGGGCTTGTC Chr16:32767034..32767053 60.31 55
downstream ENSMUSE00000619822 Chr16:32767390..32767601 TGTTGTATTGAGCCGCAAAG Chr16:32767578..32767597 59.87 45
downstream ENSMUSE00000619821 Chr16:32768777..32768861 GGGCTCAAGAAACCACTGAA Chr16:32768800..32768819 60.23 50
downstream ENSMUSE00000619820 Chr16:32769225..32769392 TCCTCTGATAGGCTGGAGGA Chr16:32769366..32769385 59.9 55
downstream ENSMUSE00000619819 Chr16:32769838..32769939 AGCTGTTTGAGGGAATGGTG Chr16:32769909..32769928 60.11 50
downstream ENSMUSE00000619818 Chr16:32770291..32770524 ATGCACTTTCTGTCGCCTTT Chr16:32770438..32770457 59.88 45
downstream ENSMUSE00000619817 Chr16:32771661..32771798 AGGCTTGAATCTTGCTGCTG Chr16:32771708..32771727 60.68 50
downstream ENSMUSE00000619816 Chr16:32774821..32775044 GTACACGCTTCTGGGGATGT Chr16:32774869..32774888 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTGTATTCTTGCCTCCTC Chr16:32745510..32745530 58.89 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTGTATTCTTGCCTCCTC Chr16:32745510..32745530 58.89 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035656