Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31701
Trapped Gene
Samhd1 (ENSMUSG00000027639)
Vector Insertion
Chr 2: 156939957 - 156942244
Public Clones IST14588G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171392 (Chr2:156942088..156942243 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGTCTCGTCCCTGAAGAA Chr2:156942151..156942170 59.65 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171392 (Chr2:156942088..156942243 -)
Downstram Exon
ENSMUSE00000171384 (Chr2:156939958..156940058 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGTCTCGTCCCTGAAGAA Chr2:156942151..156942170 59.65 50 TGTCTACGTCGATGCCATTC Chr2:156939955..156939974 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000552929 Chr2:156960615..156960899 ACGACGACTTCCAAAACACC Chr2:156960703..156960722 60.01 50
upstream ENSMUSE00000710370 Chr2:156960615..156960958 ACGACGACTTCCAAAACACC Chr2:156960703..156960722 60.01 50
upstream ENSMUSE00000715290 Chr2:156960615..156960958 ACGACGACTTCCAAAACACC Chr2:156960703..156960722 60.01 50
upstream ENSMUSE00000552920 Chr2:156955586..156955652 GGATGAGGATCGTCTGGAAG Chr2:156955599..156955618 59.61 55
upstream ENSMUSE00000552969 Chr2:156955586..156955652 GGATGAGGATCGTCTGGAAG Chr2:156955599..156955618 59.61 55
upstream ENSMUSE00000552968 Chr2:156952508..156952580 TTCCTTGGAGGAGAGGAAGA Chr2:156952561..156952580 58.94 50
upstream ENSMUSE00000711342 Chr2:156952508..156952580 TTCCTTGGAGGAGAGGAAGA Chr2:156952561..156952580 58.94 50
upstream ENSMUSE00000715442 Chr2:156952508..156952580 TTCCTTGGAGGAGAGGAAGA Chr2:156952561..156952580 58.94 50
upstream ENSMUSE00000552912 Chr2:156949025..156949185 ACACCTCAGTTCCAGCGACT Chr2:156949103..156949122 59.91 55
upstream ENSMUSE00000552967 Chr2:156949025..156949185 ACACCTCAGTTCCAGCGACT Chr2:156949103..156949122 59.91 55
upstream ENSMUSE00000552908 Chr2:156947567..156947682 GAGCACTTGCCGAAAAACAG Chr2:156947634..156947653 60.94 50
upstream ENSMUSE00000552966 Chr2:156947567..156947682 GAGCACTTGCCGAAAAACAG Chr2:156947634..156947653 60.94 50
upstream ENSMUSE00000552902 Chr2:156946218..156946288 GCCCAGAGAAAAAGTGGAAG Chr2:156946218..156946237 58.91 50
upstream ENSMUSE00000552965 Chr2:156946218..156946288 GCCCAGAGAAAAAGTGGAAG Chr2:156946218..156946237 58.91 50
upstream ENSMUSE00000639496 Chr2:156945891..156946127 GCCTGACTTCACAGGGTCAT Chr2:156945986..156946005 60.12 55
upstream ENSMUSE00000171392 Chr2:156942088..156942243 ATGGTCTCGTCCCTGAAGAA Chr2:156942151..156942170 59.65 50
upstream ENSMUSE00000171384 Chr2:156939958..156940058 GAATGGCATCGACGTAGACA Chr2:156939977..156939996 59.68 50

*** Putative Vector Insertion (Chr 2: 156939957 - 156942244) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171387 Chr2:156938536..156938677 TCGAACAAATGTGCTTCACC Chr2:156938522..156938541 59.7 45
downstream ENSMUSE00000171383 Chr2:156936284..156936375 CAGTTGCGAGTGTGGAACAT Chr2:156936313..156936332 59.75 50
downstream ENSMUSE00000171388 Chr2:156935153..156935268 GGCAGTCCCTGTAATCTCCA Chr2:156935192..156935211 60.07 55
downstream ENSMUSE00000318025 Chr2:156933165..156933301 AGATTGCGGCATTCAATGTT Chr2:156933192..156933211 60.48 40
downstream ENSMUSE00000171381 Chr2:156931967..156932059 AATCTTCGGCCTTCAGTTCA Chr2:156931956..156931975 59.81 45
downstream ENSMUSE00000318013 Chr2:156930568..156930672 AGTGAACACGATCGATTGGA Chr2:156930596..156930615 59.09 45
downstream ENSMUSE00000680697 Chr2:156929081..156930672 CCAGTGTTCTCTCCCAGAGC Chr2:156929942..156929961 59.99 60
downstream ENSMUSE00000485632 Chr2:156927457..156927594 TCTCTGGCAGCAGTTGTGAC Chr2:156927551..156927570 60.19 55
downstream ENSMUSE00000552892 Chr2:156927096..156927179 AGGGTCCTCAGCCATCTCTC Chr2:156927125..156927144 60.76 60
downstream ENSMUSE00000362562 Chr2:156923265..156925239 GGCACTTAACAGGGATGGAA Chr2:156924283..156924302 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGGGCTCCATTGAGATGT Chr2:156942217..156942237 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGGGCTCCATTGAGATGT Chr2:156942217..156942237 59.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027639