Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31703
Trapped Gene
Fgd6 (ENSMUSG00000020021)
Vector Insertion
Chr 10: 93552508 - 93563146
Public Clones IST12798G2 (tigm) IST11568F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000260947 (Chr10:93552477..93552507 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000260947 (Chr10:93552477..93552507 +)
Downstram Exon
ENSMUSE00000260943 (Chr10:93563147..93563298 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000574117 Chr10:93498906..93499055 No primer for this exon
upstream ENSMUSE00000359814 Chr10:93506047..93508378 No primer for this exon
upstream ENSMUSE00000260962 Chr10:93536928..93537075 No primer for this exon
upstream ENSMUSE00000260955 Chr10:93552322..93552389 No primer for this exon
upstream ENSMUSE00000260947 Chr10:93552477..93552507 No primer for this exon

*** Putative Vector Insertion (Chr 10: 93552508 - 93563146) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260943 Chr10:93563147..93563298 No primer for this exon
downstream ENSMUSE00000394254 Chr10:93565987..93566143 No primer for this exon
downstream ENSMUSE00000099901 Chr10:93568730..93568817 No primer for this exon
downstream ENSMUSE00000099899 Chr10:93583198..93583248 No primer for this exon
downstream ENSMUSE00000099898 Chr10:93585984..93586042 No primer for this exon
downstream ENSMUSE00000099891 Chr10:93586289..93586360 No primer for this exon
downstream ENSMUSE00000099893 Chr10:93587635..93587703 No primer for this exon
downstream ENSMUSE00000099904 Chr10:93588294..93588377 No primer for this exon
downstream ENSMUSE00000099895 Chr10:93590114..93590193 No primer for this exon
downstream ENSMUSE00000099892 Chr10:93596025..93596127 No primer for this exon
downstream ENSMUSE00000099896 Chr10:93596746..93596889 No primer for this exon
downstream ENSMUSE00000099902 Chr10:93597762..93597864 No primer for this exon
downstream ENSMUSE00000099890 Chr10:93600181..93600308 No primer for this exon
downstream ENSMUSE00000099900 Chr10:93601029..93601157 No primer for this exon
downstream ENSMUSE00000099897 Chr10:93602484..93602632 No primer for this exon
downstream ENSMUSE00000099903 Chr10:93604498..93608083 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCTACCACCTTCTTCTTTG Chr10:93552464..93552485 59.36 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTCCTTTCCCTGCGTGAC Chr10:93552545..93552565 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020021