Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31714
Trapped Gene
Cdk5rap1 (ENSMUSG00000027487)
Vector Insertion
Chr 2: 154174386 - 154176610
Public Clones IST10954F12 (tigm) IST12856D1 (tigm) IST14196C9 (tigm) IST14174A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000340759 (Chr2:154176554..154176609 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGAGAAGCATATGTGGCATT Chr2:154176583..154176604 59.25 40.91 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000340759 (Chr2:154176554..154176609 -)
Downstram Exon
ENSMUSE00000364306 (Chr2:154174387..154174517 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGAGAAGCATATGTGGCATT Chr2:154176583..154176604 59.25 40.91 AAGTCGCTGCTAAGGCTCAC Chr2:154174474..154174493 59.79 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681354 Chr2:154198698..154198746 GCTCTTAACCGCTGAACCAT Chr2:154198718..154198737 59.34 50
upstream ENSMUSE00000469194 Chr2:154198417..154198463 GATCGACAGTTTCCGGTTTC Chr2:154198443..154198462 59.53 50
upstream ENSMUSE00000681353 Chr2:154198417..154198590 CGGCAGGAAACACTACCATT Chr2:154198549..154198568 59.99 50
upstream ENSMUSE00000170026 Chr2:154196372..154196691 CATGCATCCTTTACGGTGTG Chr2:154196654..154196673 59.99 50
upstream ENSMUSE00000718646 Chr2:154196372..154196691 TGTGTCCAGCACTCCTTGTC Chr2:154196555..154196574 59.87 55
upstream ENSMUSE00000170032 Chr2:154194548..154194651 GGCTGTCAGATGAACGTGAA Chr2:154194615..154194634 59.84 50
upstream ENSMUSE00000170033 Chr2:154193950..154193984 No primer for this exon
upstream ENSMUSE00000328168 Chr2:154191698..154191798 CCACGCTCTCGAGTACCTCT Chr2:154191715..154191734 59.62 60
upstream ENSMUSE00000681351 Chr2:154187570..154187601 GTTTCAACTCCAGCCTCCTG Chr2:154187571..154187590 59.84 55
upstream ENSMUSE00000328164 Chr2:154186293..154186503 TATCATGCCAGTCCAGACGA Chr2:154186318..154186337 60.22 50
upstream ENSMUSE00000328159 Chr2:154179826..154179946 AGTTGCCTCCATTCTCGATG Chr2:154179849..154179868 60.22 50
upstream ENSMUSE00000328152 Chr2:154178926..154179156 AGGAGGGCTTCGTTTTTCTC Chr2:154179009..154179028 59.83 50
upstream ENSMUSE00000170035 Chr2:154177918..154178015 GAAGCAGCCGTGTACTGGAT Chr2:154177932..154177951 60.28 55
upstream ENSMUSE00000340759 Chr2:154176554..154176609 CAAGAGAAGCATATGTGGCATT Chr2:154176583..154176604 59.25 40.91
upstream ENSMUSE00000364306 Chr2:154174387..154174517 GCCTTAGCAGCGACTTCATC Chr2:154174492..154174511 60.12 55

*** Putative Vector Insertion (Chr 2: 154174386 - 154176610) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170027 Chr2:154171602..154171751 GGCTACAACCCACTGAGGTC Chr2:154171600..154171619 59.58 60
downstream ENSMUSE00000170019 Chr2:154168037..154168177 CTTGAGCCCAGGGTTAGTGA Chr2:154168051..154168070 60.25 55
downstream ENSMUSE00000385117 Chr2:154161116..154161353 ATTTGGTGCAAAGGTGCTTC Chr2:154161161..154161180 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTAATCGCCTTGCAGCAC Chr2:154176542..154176562 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACTCGTGACTGGGAAAACC Chr2:154176543..154176564 60.54 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027487