Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31722
Trapped Gene
Chst3 (ENSMUSG00000057337)
Vector Insertion
Chr 10: 59644281 - 59651456
Public Clones IST11646A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000511074 (Chr10:59650821..59651455 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTGGCATTTGTGGTCATA Chr10:59650862..59650881 59.92 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000511074 (Chr10:59650821..59651455 -)
Downstram Exon
ENSMUSE00000419013 (Chr10:59644282..59649631 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTGGCATTTGTGGTCATA Chr10:59650862..59650881 59.92 45 AGGTTGACCAGACCCACTTG Chr10:59645290..59645309 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000511074 Chr10:59650821..59651455 TCCTGGCATTTGTGGTCATA Chr10:59650862..59650881 59.92 45
upstream ENSMUSE00000419013 Chr10:59644282..59649631 GCCTTGGTCTACCGTGATGT Chr10:59649218..59649237 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGGACTTGTCCCTTTGA Chr10:59645472..59645492 60.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGGACTTGTCCCTTTGA Chr10:59645472..59645492 60.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057337