Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31726
Trapped Gene
Adamts2 (ENSMUSG00000036545)
Vector Insertion
Chr 11: 50415802 - 50416738
Public Clones IST10672B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000295779 (Chr11:50415587..50415801 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCTACTGCTGCTGCTGCT Chr11:50415708..50415727 61.19 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000295779 (Chr11:50415587..50415801 +)
Downstram Exon
ENSMUSE00000295772 (Chr11:50416739..50417133 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCTACTGCTGCTGCTGCT Chr11:50415708..50415727 61.19 60 GGTAAGTCTGCCACGTCTCC Chr11:50417096..50417115 59.73 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000295779 Chr11:50415587..50415801 GCTCTACTGCTGCTGCTGCT Chr11:50415708..50415727 61.19 60

*** Putative Vector Insertion (Chr 11: 50415802 - 50416738) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000295772 Chr11:50416739..50417133 GGTAAGTCTGCCACGTCTCC Chr11:50417096..50417115 59.73 60
downstream ENSMUSE00000295927 Chr11:50481493..50481652 CTTGTTCAGCCTCCTGATCC Chr11:50481577..50481596 59.8 55
downstream ENSMUSE00000295834 Chr11:50550668..50550870 GAACTGGACCACCGAGTCAT Chr11:50550825..50550844 59.97 55
downstream ENSMUSE00000295914 Chr11:50570198..50570281 TAATCCTCACCAGCACCACA Chr11:50570264..50570283 60.11 50
downstream ENSMUSE00000295904 Chr11:50586719..50586875 AATCCTGCCGTGTGAGAAAG Chr11:50586857..50586876 60.26 50
downstream ENSMUSE00000580012 Chr11:50588816..50588921 AGAGTACAGCTGCGGACAGG Chr11:50588867..50588886 60.61 60
downstream ENSMUSE00000580011 Chr11:50589621..50589764 ACCAGTGGAAGCGATGGAAG Chr11:50589730..50589749 62.53 55
downstream ENSMUSE00000580010 Chr11:50590124..50590256 GTAACCCAGGCCAAAGTCAA Chr11:50590244..50590263 59.97 50
downstream ENSMUSE00000580009 Chr11:50590633..50590746 CCAGTGGAGGACCCTTCTTT Chr11:50590723..50590742 60.48 55
downstream ENSMUSE00000295870 Chr11:50593195..50593340 CGTTTGAGGATATCGGGTGT Chr11:50593247..50593266 59.81 50
downstream ENSMUSE00000295865 Chr11:50595207..50595382 CACCGTGCTCAAAGTACAGG Chr11:50595346..50595365 59.36 55
downstream ENSMUSE00000295860 Chr11:50598105..50598238 TGAAGGCGTCCTTGTAGGAG Chr11:50598215..50598234 60.39 55
downstream ENSMUSE00000295852 Chr11:50599050..50599173 CACACGCCACACTTGTCTTC Chr11:50599111..50599130 60.36 55
downstream ENSMUSE00000295845 Chr11:50600088..50600168 CGGGGATCTCAAACATCTTG Chr11:50600117..50600136 60.45 50
downstream ENSMUSE00000295841 Chr11:50600691..50600857 GGGGTCCAAGTGGTTCTCTT Chr11:50600752..50600771 60.35 55
downstream ENSMUSE00000353160 Chr11:50602157..50602316 ACATTGAGGGAGTCCTCGTG Chr11:50602230..50602249 60.11 55
downstream ENSMUSE00000295809 Chr11:50605305..50605437 CAGAAGGCTCGGTGTACCAT Chr11:50605374..50605393 60.13 55
downstream ENSMUSE00000295804 Chr11:50606148..50606355 GGTGATCGTTGCAGTGTTTG Chr11:50606287..50606306 60.16 50
downstream ENSMUSE00000295794 Chr11:50608820..50608949 GTTGCCACAGGTTACCGAAC Chr11:50608843..50608862 60.42 55
downstream ENSMUSE00000295764 Chr11:50609941..50610030 GACAGCCACTGAACCACGTA Chr11:50609992..50610011 59.75 55
downstream ENSMUSE00000349744 Chr11:50617071..50617551 GGATGGAGCAGTAGCGAGAC Chr11:50617142..50617161 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000036545