Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31727
Trapped Gene
AC105966.11 (ENSMUSG00000078750)
Vector Insertion
Chr 3: 51256302 - 51292231
Public Clones (sanger) IST14703F2 (tigm) IST14303C10 (tigm) IST14285E5 (tigm) IST11873G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675343 (Chr3:51292204..51292230 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675343 (Chr3:51292204..51292230 -)
Downstram Exon
ENSMUSE00000675342 (Chr3:51256303..51256361 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACAGAAACAGGCACACATGC Chr3:51256297..51256316 59.76 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675343 Chr3:51292204..51292230 No primer for this exon
upstream ENSMUSE00000675342 Chr3:51256303..51256361 GCATGTGTGCCTGTTTCTGT Chr3:51256319..51256338 59.76 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:51280161..51280181 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTTCTTTCTCTCCGTGACT Chr3:51280173..51280194 60.01 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078750