Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31736
Trapped Gene
Exoc7 (ENSMUSG00000020792)
Vector Insertion
Chr 11: 116167927 - 116168299
Public Clones IST14100A8 (tigm) IST13738B8 (tigm) IST13738B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669828 (Chr11:116168203..116168298 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669828 (Chr11:116168203..116168298 -)
Downstram Exon
ENSMUSE00000109320 (Chr11:116167928..116168039 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669828 Chr11:116168203..116168298 No primer for this exon
upstream ENSMUSE00000109320 Chr11:116167928..116168039 No primer for this exon

*** Putative Vector Insertion (Chr 11: 116167927 - 116168299) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109316 Chr11:116167702..116167767 No primer for this exon
downstream ENSMUSE00000109340 Chr11:116166178..116166362 No primer for this exon
downstream ENSMUSE00000715890 Chr11:116165891..116165996 No primer for this exon
downstream ENSMUSE00000722222 Chr11:116165891..116165996 No primer for this exon
downstream ENSMUSE00000109329 Chr11:116162418..116162640 No primer for this exon
downstream ENSMUSE00000646073 Chr11:116162418..116162640 No primer for this exon
downstream ENSMUSE00000669827 Chr11:116161618..116161747 No primer for this exon
downstream ENSMUSE00000109333 Chr11:116161580..116161747 No primer for this exon
downstream ENSMUSE00000646071 Chr11:116161580..116161747 No primer for this exon
downstream ENSMUSE00000109331 Chr11:116158885..116158977 No primer for this exon
downstream ENSMUSE00000669835 Chr11:116158044..116158112 No primer for this exon
downstream ENSMUSE00000646069 Chr11:116156858..116157003 No primer for this exon
downstream ENSMUSE00000710835 Chr11:116156858..116157003 No primer for this exon
downstream ENSMUSE00000713944 Chr11:116156858..116157003 No primer for this exon
downstream ENSMUSE00000109341 Chr11:116156488..116156640 No primer for this exon
downstream ENSMUSE00000646067 Chr11:116156488..116156640 No primer for this exon
downstream ENSMUSE00000109342 Chr11:116156056..116156154 No primer for this exon
downstream ENSMUSE00000646065 Chr11:116156056..116156154 No primer for this exon
downstream ENSMUSE00000109327 Chr11:116155721..116155783 No primer for this exon
downstream ENSMUSE00000646064 Chr11:116155721..116155783 No primer for this exon
downstream ENSMUSE00000109337 Chr11:116155286..116155352 No primer for this exon
downstream ENSMUSE00000646062 Chr11:116155286..116155352 No primer for this exon
downstream ENSMUSE00000109312 Chr11:116154589..116154627 No primer for this exon
downstream ENSMUSE00000109313 Chr11:116153833..116153898 No primer for this exon
downstream ENSMUSE00000646061 Chr11:116153833..116153898 No primer for this exon
downstream ENSMUSE00000109314 Chr11:116152768..116152888 No primer for this exon
downstream ENSMUSE00000646059 Chr11:116152768..116152888 No primer for this exon
downstream ENSMUSE00000109318 Chr11:116152453..116152548 No primer for this exon
downstream ENSMUSE00000646058 Chr11:116152453..116152548 No primer for this exon
downstream ENSMUSE00000109335 Chr11:116151521..116151584 No primer for this exon
downstream ENSMUSE00000646057 Chr11:116151521..116151584 No primer for this exon
downstream ENSMUSE00000109310 Chr11:116151264..116151305 No primer for this exon
downstream ENSMUSE00000646056 Chr11:116151264..116151305 No primer for this exon
downstream ENSMUSE00000109325 Chr11:116150839..116150972 No primer for this exon
downstream ENSMUSE00000646055 Chr11:116150839..116150972 No primer for this exon
downstream ENSMUSE00000646040 Chr11:116150424..116150599 No primer for this exon
downstream ENSMUSE00000646053 Chr11:116150424..116150599 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGGAGCTAATCGCCTTGC Chr11:116168236..116168256 60.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTCAAAGGAGCCGTGACT Chr11:116168241..116168261 59.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020792