Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31739
Trapped Gene
AC121839.3-202 (ENSMUSG00000071224)
Vector Insertion
Chr 13: 99075410 - 99075675
Public Clones IST14096B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000611338 (Chr13:99075266..99075409 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGGACAGATTCACAGCAA Chr13:99075284..99075303 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000611338 (Chr13:99075266..99075409 +)
Downstram Exon
ENSMUSE00000611337 (Chr13:99075676..99075798 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGGACAGATTCACAGCAA Chr13:99075284..99075303 59.99 50 CTGGTGTCACACACCCTGTC Chr13:99075769..99075788 60.04 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680196 Chr13:99049893..99049933 GCAGATCGGCAGGAATAAAA Chr13:99049913..99049932 60.17 45
upstream ENSMUSE00000680194 Chr13:99053444..99053529 AGGGAGCATTGTTCACCAAA Chr13:99053457..99053476 60.49 45
upstream ENSMUSE00000680193 Chr13:99057213..99057276 CTTTGGATCGGCATCGTAAA Chr13:99057253..99057272 60.96 45
upstream ENSMUSE00000611339 Chr13:99072460..99072582 ACTTCTTGCGGGGTATTCCT Chr13:99072495..99072514 59.96 50
upstream ENSMUSE00000611338 Chr13:99075266..99075409 GCAGGACAGATTCACAGCAA Chr13:99075284..99075303 59.99 50

*** Putative Vector Insertion (Chr 13: 99075410 - 99075675) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000611337 Chr13:99075676..99075798 CTGGTGTCACACACCCTGTC Chr13:99075769..99075788 60.04 60
downstream ENSMUSE00000611336 Chr13:99076911..99077047 ACTCCAGTCGGCACAGTCTT Chr13:99077029..99077048 59.91 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCTGTGGTGAGGTGGACT Chr13:99075403..99075423 60.15 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCTGTGGTGAGGTGGACT Chr13:99075403..99075423 60.15 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071224