Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31749
Trapped Gene
Grip1 (ENSMUSG00000034813)
Vector Insertion
Chr 10: 119256691 - 119334770
Public Clones IST12435C8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640005 (Chr10:119256445..119256690 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACATGTAGCGGACCTCTG Chr10:119256466..119256485 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640005 (Chr10:119256445..119256690 +)
Downstram Exon
ENSMUSE00000487326 (Chr10:119334771..119334851 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACATGTAGCGGACCTCTG Chr10:119256466..119256485 59.85 55 CTTTGTCTGGCTGGCAGATT Chr10:119334811..119334830 60.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665544 Chr10:118891421..118891478 ATCTGCTTACAAGCGGAGGA Chr10:118891448..118891467 59.98 50
upstream ENSMUSE00000640005 Chr10:119256445..119256690 TGACATGTAGCGGACCTCTG Chr10:119256466..119256485 59.85 55

*** Putative Vector Insertion (Chr 10: 119256691 - 119334770) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487326 Chr10:119334771..119334851 CTTTGTCTGGCTGGCAGATT Chr10:119334811..119334830 60.4 50
downstream ENSMUSE00000476972 Chr10:119366957..119367092 ATACCGTCAGGCCAAGAGTG Chr10:119367028..119367047 60.13 55
downstream ENSMUSE00000489184 Chr10:119368300..119368445 AAGCTCGTACTCGACCTCCA Chr10:119368438..119368457 60.01 55
downstream ENSMUSE00000517574 Chr10:119375300..119375383 TCGGATGACAAAACCAAAGG Chr10:119375385..119375404 60.86 45
downstream ENSMUSE00000496738 Chr10:119379918..119379993 CTCCAGGACGAACACAGGTT Chr10:119379983..119380002 60.15 55
downstream ENSMUSE00000514917 Chr10:119382082..119382227 GCTTCTTGTCCGCACTGTTT Chr10:119382195..119382214 60.44 50
downstream ENSMUSE00000493118 Chr10:119412926..119413073 GCACACGGAGGTAGTTAGGG Chr10:119413020..119413039 59.62 60
downstream ENSMUSE00000494902 Chr10:119415494..119415663 GATGTGGTCTCCCACGTGTA Chr10:119415527..119415546 59.39 55
downstream ENSMUSE00000502892 Chr10:119422530..119422685 ATGGTCTGGGTGGTACGTGT Chr10:119422636..119422655 60.16 55
downstream ENSMUSE00000492138 Chr10:119423388..119423540 CTGGTGGAGTAGAGGCTTCG Chr10:119423487..119423506 60.01 60
downstream ENSMUSE00000492454 Chr10:119430162..119430298 TCCTTTCAGCTCGTTTTGCT Chr10:119430220..119430239 60.13 45
downstream ENSMUSE00000665542 Chr10:119430193..119430298 TCCTTTCAGCTCGTTTTGCT Chr10:119430220..119430239 60.13 45
downstream ENSMUSE00000474539 Chr10:119436808..119436994 AGAGCGTCTCTGTGGCAAAC Chr10:119436948..119436967 60.6 55
downstream ENSMUSE00000472897 Chr10:119437582..119437727 TTCCTCGAAGGTGCTGTCTT Chr10:119437660..119437679 59.99 50
downstream ENSMUSE00000475398 Chr10:119447262..119447342 AAGTTCCACGCTGTGCTTCT Chr10:119447329..119447348 60.06 50
downstream ENSMUSE00000469279 Chr10:119455129..119455198 CCCCGGTTTTCTACTGGATG Chr10:119455154..119455173 61.6 55
downstream ENSMUSE00000470919 Chr10:119457017..119457162 CTTTGCGGATTTTGAGCTTC Chr10:119457150..119457169 59.96 45
downstream ENSMUSE00000467967 Chr10:119472407..119472551 AATCGCTCCGGAACTCTCTT Chr10:119472435..119472454 60.35 50
downstream ENSMUSE00000573681 Chr10:119475347..119475486 CAAGTGGATGGCTTCACTCA Chr10:119475437..119475456 59.83 50
downstream ENSMUSE00000573680 Chr10:119475655..119475849 GCTGGCATCTATTCCAGACC Chr10:119475839..119475858 59.66 55
downstream ENSMUSE00000501439 Chr10:119486407..119486563 GACAGGCTGGTTCTTTGCTT Chr10:119486485..119486504 59.48 50
downstream ENSMUSE00000478997 Chr10:119487061..119487172 GTCCTCCAATGCTTGAGACC Chr10:119487133..119487152 59.66 55
downstream ENSMUSE00000488031 Chr10:119487288..119487332 ACACGCCTGTCAGCTTTCTC Chr10:119487310..119487329 60.6 55
downstream ENSMUSE00000489642 Chr10:119491889..119492122 TTCATTTTCCGCAGGGTTAC Chr10:119492076..119492095 59.94 45
downstream ENSMUSE00000447075 Chr10:119509687..119509833 TGGGCGGATATTTTTGACAT Chr10:119509785..119509804 60.15 40
downstream ENSMUSE00000482277 Chr10:119512346..119512619 CCGGCTGTTCTATCGACTTC Chr10:119512478..119512497 59.84 55
downstream ENSMUSE00000573676 Chr10:119512346..119512535 CCGGCTGTTCTATCGACTTC Chr10:119512478..119512497 59.84 55
downstream ENSMUSE00000665543 Chr10:119512346..119514190 TGCCTGCGCAGTTGTATTAG Chr10:119513847..119513866 60.04 50
downstream ENSMUSE00000573675 Chr10:119514284..119514443 AATTGCGCCACATTCTGAGT Chr10:119514406..119514425 60.67 45
downstream ENSMUSE00000573674 Chr10:119524008..119524316 GGGGATGATGCTCTTTCTCA Chr10:119524068..119524087 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTAGAGCGGTGTGAGAGAT Chr10:119325645..119325666 58.56 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTAGAGCGGTGTGAGAGAT Chr10:119325645..119325666 58.56 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034813