Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31752
Trapped Gene
Sertad2 (ENSMUSG00000049800)
Vector Insertion
Chr 11: 20532277 - 20547157
Public Clones (ggtc) (ggtc) 3SE306E09 (ggtc) (ggtc) 3SE311D01 (ggtc) (ggtc)
IST14451H1 (tigm) IST14455E4 (tigm) IST14579F3 (tigm) IST14416C2 (tigm)
IST13241B11 (tigm) IST10938H1 (tigm) IST10178B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680843 (Chr11:20531980..20532276 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGAGCACGAGCTGTACCT Chr11:20532019..20532038 60.61 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680843 (Chr11:20531980..20532276 +)
Downstram Exon
ENSMUSE00000680841 (Chr11:20547158..20547355 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGAGCACGAGCTGTACCT Chr11:20532019..20532038 60.61 60 CTTCTTGCCTGTCGGGTATC Chr11:20547298..20547317 59.69 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000593852 Chr11:20443256..20443763 GTATCGCCCCTTTAGCCTGT Chr11:20443494..20443513 60.47 55
upstream ENSMUSE00000680843 Chr11:20531980..20532276 CTGGAGCACGAGCTGTACCT Chr11:20532019..20532038 60.61 60

*** Putative Vector Insertion (Chr 11: 20532277 - 20547157) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000680841 Chr11:20547158..20547355 CTTCTTGCCTGTCGGGTATC Chr11:20547298..20547317 59.69 55
downstream ENSMUSE00000580920 Chr11:20547805..20553026 AAGCAACCAGATTGGACACC Chr11:20550326..20550345 59.97 50
downstream ENSMUSE00000680840 Chr11:20547805..20549068 GGGGTCAAAATCGTACATGG Chr11:20548576..20548595 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGAGGAAAGTTGTGCTGA Chr11:20532235..20532255 59.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGAAACCCTTATGAACGTG Chr11:20538312..20538332 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049800