Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31759
Trapped Gene
Adamtsl4 (ENSMUSG00000015850)
Vector Insertion
Chr 3: 95481730 - 95483688
Public Clones (sanger) CMHD-GT_535H3-3 (cmhd) CMHD-GT_535H3-5S (cmhd) IST13514G12 (tigm)
IST13960D5 (tigm) IST14420A11 (tigm) IST10591E2 (tigm) IST12782B1 (tigm)
IST14753G6 (tigm) IST10299A1 (tigm) IST11067H6 (tigm) IST11067H6 (tigm)
IST10591E2 (tigm) IST13960D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176255 (Chr3:95483511..95483687 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176255 (Chr3:95483511..95483687 -)
Downstram Exon
ENSMUSE00000176257 (Chr3:95481731..95481928 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000502296 Chr3:95491744..95491781 No primer for this exon
upstream ENSMUSE00000716153 Chr3:95491744..95491840 No primer for this exon
upstream ENSMUSE00000449694 Chr3:95489379..95489476 No primer for this exon
upstream ENSMUSE00000710947 Chr3:95489379..95489594 No primer for this exon
upstream ENSMUSE00000449684 Chr3:95488882..95488939 No primer for this exon
upstream ENSMUSE00000449680 Chr3:95488284..95488621 No primer for this exon
upstream ENSMUSE00000449678 Chr3:95487556..95488162 No primer for this exon
upstream ENSMUSE00000449676 Chr3:95487231..95487333 No primer for this exon
upstream ENSMUSE00000449674 Chr3:95486133..95486269 No primer for this exon
upstream ENSMUSE00000449670 Chr3:95485575..95485779 No primer for this exon
upstream ENSMUSE00000449668 Chr3:95485183..95485355 No primer for this exon
upstream ENSMUSE00000449664 Chr3:95484947..95485058 No primer for this exon
upstream ENSMUSE00000449659 Chr3:95484660..95484845 No primer for this exon
upstream ENSMUSE00000449654 Chr3:95484368..95484497 No primer for this exon
upstream ENSMUSE00000449650 Chr3:95483914..95484118 No primer for this exon
upstream ENSMUSE00000176255 Chr3:95483511..95483687 No primer for this exon
upstream ENSMUSE00000176257 Chr3:95481731..95481928 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95481730 - 95483688) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176256 Chr3:95481451..95481630 No primer for this exon
downstream ENSMUSE00000176258 Chr3:95481034..95481178 No primer for this exon
downstream ENSMUSE00000389156 Chr3:95480127..95480892 No primer for this exon
downstream ENSMUSE00000720708 Chr3:95480124..95480892 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAAGTTCGGTGTGTAATCG Chr3:95483631..95483651 59.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGGTCTCTCATCCTTCAG Chr3:95483686..95483706 60.34 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTCTGGCAAATCTGCCTTC Chr3:95483477..95483497 59.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTCTGGCAAATCTGCCTTC Chr3:95483477..95483497 59.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015850