Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31777
Trapped Gene
Cldn11 (ENSMUSG00000037625)
Vector Insertion
Chr 3: 31053001 - 31061997
Public Clones IST11648B11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273287 (Chr3:31052836..31053000 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGTGCTCCTTATTCTGCTG Chr3:31052980..31052999 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273287 (Chr3:31052836..31053000 +)
Downstram Exon
ENSMUSE00000494467 (Chr3:31061998..31063240 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGTGCTCCTTATTCTGCTG Chr3:31052980..31052999 59.84 55 CAACCTGCGTACAGCGAGTA Chr3:31062094..31062113 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000273293 Chr3:31048868..31049297 CACAATCCGTGTGAGTCGAG Chr3:31049027..31049046 60.31 55
upstream ENSMUSE00000273287 Chr3:31052836..31053000 GGGTGCTCCTTATTCTGCTG Chr3:31052980..31052999 59.84 55

*** Putative Vector Insertion (Chr 3: 31053001 - 31061997) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000494467 Chr3:31061998..31063240 CAACCTGCGTACAGCGAGTA Chr3:31062094..31062113 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATCCCAACTCCAGTGAAT Chr3:31053018..31053038 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATCCCAACTCCAGTGAAT Chr3:31053018..31053038 59.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037625