Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31793
Trapped Gene
Dnaja3 (ENSMUSG00000004069)
Vector Insertion
Chr 16: 4684345 - 4687236
Public Clones IST11743D10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000707554 (Chr16:4684134..4684344 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000707554 (Chr16:4684134..4684344 +)
Downstram Exon
ENSMUSE00000293866 (Chr16:4687237..4687370 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000293876 Chr16:4684123..4684344 No primer for this exon
upstream ENSMUSE00000707554 Chr16:4684134..4684344 No primer for this exon

*** Putative Vector Insertion (Chr 16: 4684345 - 4687236) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000293866 Chr16:4687237..4687370 No primer for this exon
downstream ENSMUSE00000127792 Chr16:4689981..4690064 No primer for this exon
downstream ENSMUSE00000293851 Chr16:4693212..4693412 No primer for this exon
downstream ENSMUSE00000293783 Chr16:4694364..4694516 No primer for this exon
downstream ENSMUSE00000127796 Chr16:4696389..4696536 No primer for this exon
downstream ENSMUSE00000127795 Chr16:4697251..4697315 No primer for this exon
downstream ENSMUSE00000127793 Chr16:4699749..4699877 No primer for this exon
downstream ENSMUSE00000127790 Chr16:4701169..4701284 No primer for this exon
downstream ENSMUSE00000127794 Chr16:4702211..4702308 No primer for this exon
downstream ENSMUSE00000127799 Chr16:4705844..4705960 No primer for this exon
downstream ENSMUSE00000564297 Chr16:4706568..4707691 No primer for this exon
downstream ENSMUSE00000704380 Chr16:4706568..4707691 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr16:4684395..4684415 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGATTAGAAAGGGCGTGAC Chr16:4684382..4684402 60.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004069