Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31794
Trapped Gene
Mrps36 (ENSMUSG00000061474)
Vector Insertion
Chr 13: 101508968 - 101511187
Public Clones IST10918D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679953 (Chr13:101511123..101511186 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679953 (Chr13:101511123..101511186 -)
Downstram Exon
ENSMUSE00000461723 (Chr13:101508969..101509156 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCAGTAAATCGGGGGACGTA Chr13:101509045..101509064 60.32 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679942 Chr13:101514485..101514612 GCTGCCCACTCCAGATACTT Chr13:101514571..101514590 59.31 55
upstream ENSMUSE00000679954 Chr13:101514485..101514614 GCTGCCCACTCCAGATACTT Chr13:101514571..101514590 59.31 55
upstream ENSMUSE00000679953 Chr13:101511123..101511186 No primer for this exon
upstream ENSMUSE00000461723 Chr13:101508969..101509156 TACGTCCCCCGATTTACTGA Chr13:101509067..101509086 60.32 50
upstream ENSMUSE00000679941 Chr13:101508969..101509150 TACGTCCCCCGATTTACTGA Chr13:101509067..101509086 60.32 50

*** Putative Vector Insertion (Chr 13: 101508968 - 101511187) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679940 Chr13:101506032..101506228 GCTAACCCTTCTGTCTGGTGA Chr13:101506149..101506169 59.34 52.38
downstream ENSMUSE00000679946 Chr13:101505910..101506228 GCAGCTGACCGAGATACACA Chr13:101506009..101506028 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000061474