Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31798
Trapped Gene
4632428N05Rik (ENSMUSG00000020101)
Vector Insertion
Chr 10: 59812162 - 59820589
Public Clones IST13176F11 (tigm) IST13176F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666285 (Chr10:59812071..59812161 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666285 (Chr10:59812071..59812161 +)
Downstram Exon
ENSMUSE00000666284 (Chr10:59820590..59821015 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666287 Chr10:59809599..59809851 No primer for this exon
upstream ENSMUSE00000358093 Chr10:59809652..59809851 No primer for this exon
upstream ENSMUSE00000666285 Chr10:59812071..59812161 No primer for this exon

*** Putative Vector Insertion (Chr 10: 59812162 - 59820589) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000279325 Chr10:59820590..59821015 No primer for this exon
downstream ENSMUSE00000666284 Chr10:59820590..59821015 No primer for this exon
downstream ENSMUSE00000279318 Chr10:59821692..59821742 No primer for this exon
downstream ENSMUSE00000100647 Chr10:59826949..59827056 No primer for this exon
downstream ENSMUSE00000666288 Chr10:59830514..59830541 No primer for this exon
downstream ENSMUSE00000100649 Chr10:59831277..59831473 No primer for this exon
downstream ENSMUSE00000666286 Chr10:59831280..59831473 No primer for this exon
downstream ENSMUSE00000279306 Chr10:59831650..59835432 No primer for this exon
downstream ENSMUSE00000666283 Chr10:59831650..59832041 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGAGTCTGCGGCTAATCG Chr10:59818199..59818219 60.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGACAGCTCTTCCTGTCTG Chr10:59818113..59818133 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020101