Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31799
Trapped Gene
Cdx4 (ENSMUSG00000031326)
Vector Insertion
Chr X: 100517395 - 100523347
Public Clones IST11647D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000208306 (ChrX:100516737..100517394 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCGGATCCCCAGACTACAG ChrX:100517214..100517233 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000208306 (ChrX:100516737..100517394 +)
Downstram Exon
ENSMUSE00000548563 (ChrX:100523348..100523493 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCGGATCCCCAGACTACAG ChrX:100517214..100517233 60.06 55 CCAGCTCTGACTTCCTCCTG ChrX:100523467..100523486 60.13 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000208306 ChrX:100516737..100517394 TTCGGATCCCCAGACTACAG ChrX:100517214..100517233 60.06 55

*** Putative Vector Insertion (Chr X: 100517395 - 100523347) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000548563 ChrX:100523348..100523493 CCAGCTCTGACTTCCTCCTG ChrX:100523467..100523486 60.13 60
downstream ENSMUSE00000284254 ChrX:100524773..100525563 GAAATCCACGGACAGCAGAT ChrX:100524944..100524963 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTTCCGCTGTTTCTTCTCT ChrX:100520409..100520429 59.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCACTGGCCACTAAGGAA ChrX:100517413..100517433 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031326