Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31805
Trapped Gene
A330021E22Rik (ENSMUSG00000040473)
Vector Insertion
Chr 5: 5604273 - 5613851
Public Clones IST12482F10 (tigm) IST11430B3 (tigm) IST10886H6 (tigm) IST11430D8 (tigm)
IST11640B4 (tigm) IST14869D1 (tigm) IST14522F10 (tigm) IST11512A4 (tigm)
IST13719B10 (tigm) IST14623D10 (tigm) IST13533C5 (tigm) IST13191F11 (tigm)
IST14601E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000301156 (Chr5:5613686..5613850 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACAAGTTCGCCCAGATG Chr5:5613783..5613802 60.64 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000301156 (Chr5:5613686..5613850 -)
Downstram Exon
ENSMUSE00000301152 (Chr5:5604274..5604392 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACAAGTTCGCCCAGATG Chr5:5613783..5613802 60.64 50 CTCAGCAGGTCTGCTCATCA Chr5:5604336..5604355 60.29 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000347631 Chr5:5663908..5664181 AGCTCAGCAGCGTGTTTTCT Chr5:5664093..5664112 60.34 50
upstream ENSMUSE00000402663 Chr5:5657788..5657847 CAAGCCTATGGACCTTAATCG Chr5:5657819..5657839 58.73 47.62
upstream ENSMUSE00000361918 Chr5:5649790..5649855 No primer for this exon
upstream ENSMUSE00000390808 Chr5:5646936..5647045 AAATTGAAAAGCAGCCCTGT Chr5:5646974..5646993 58.84 40
upstream ENSMUSE00000347856 Chr5:5644424..5644500 No primer for this exon
upstream ENSMUSE00000386172 Chr5:5640129..5640227 No primer for this exon
upstream ENSMUSE00000345486 Chr5:5626009..5626158 GGCACTCCTGCTTGAGAATC Chr5:5626063..5626082 59.96 55
upstream ENSMUSE00000333667 Chr5:5625750..5625927 TTAATGGTGAAAGCCCAAGC Chr5:5625894..5625913 60.07 45
upstream ENSMUSE00000389664 Chr5:5621920..5622043 CTTTGTGAGGGGGCATAGTC Chr5:5621997..5622016 59.55 55
upstream ENSMUSE00000402443 Chr5:5619167..5619215 TGTGGCTTTACCAGGGATTT Chr5:5619193..5619212 59.43 45
upstream ENSMUSE00000361655 Chr5:5618948..5619069 No primer for this exon
upstream ENSMUSE00000351918 Chr5:5617169..5617385 TTCTCGGATCCTTGCATTTC Chr5:5617190..5617209 60.15 45
upstream ENSMUSE00000301156 Chr5:5613686..5613850 GAAACAAGTTCGCCCAGATG Chr5:5613783..5613802 60.64 50
upstream ENSMUSE00000301152 Chr5:5604274..5604392 GCCATTGCCTTAGAAATCCA Chr5:5604329..5604348 60.04 45

*** Putative Vector Insertion (Chr 5: 5604273 - 5613851) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000301144 Chr5:5595921..5596039 CATTGTAGCCTAAACCCCTCTG Chr5:5595930..5595951 60.01 50
downstream ENSMUSE00000301138 Chr5:5593772..5593853 AACATCCCAAAATGCAGCAC Chr5:5593812..5593831 60.9 45
downstream ENSMUSE00000379846 Chr5:5589175..5589213 AATTAAAAGGCTGGCAGCAG Chr5:5589162..5589181 59.5 45
downstream ENSMUSE00000301133 Chr5:5589120..5589312 AACAATCTTGCCGTTCCTGT Chr5:5589099..5589118 59.6 45
downstream ENSMUSE00000369220 Chr5:5587141..5587278 AAGGGGCATGGTCTTTTGTT Chr5:5587201..5587220 60.72 45
downstream ENSMUSE00000301126 Chr5:5586356..5586432 GGCAGATAAGCCCGGTAAGT Chr5:5586382..5586401 60.47 55
downstream ENSMUSE00000301117 Chr5:5584651..5584848 GACGCAACCATCTTTCCAAT Chr5:5584699..5584718 59.94 45
downstream ENSMUSE00000301108 Chr5:5582442..5582528 CCATGACTTGTTAGCCTGCTC Chr5:5582462..5582482 59.89 52.38
downstream ENSMUSE00000301102 Chr5:5581904..5582008 TGTTGCATTCTGTGGTCGTT Chr5:5581918..5581937 60.16 45
downstream ENSMUSE00000391705 Chr5:5579282..5581366 CAGGGCAACCTAGACACCAT Chr5:5579368..5579387 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTGTTAATCGCCTTGCAG Chr5:5613786..5613806 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCACAGATTCCTACTTCATTCA Chr5:5613833..5613856 60.36 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040473