Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31806
Trapped Gene
Casz1 (ENSMUSG00000028977)
Vector Insertion
Chr 4: 148264486 - 148275813
Public Clones IST10414E10 (tigm) IST14457D12 (tigm) IST12024A9 (tigm) IST10788E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000523892 (Chr4:148264431..148264485 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATCTCTAGGACCCCGTGA Chr4:148264465..148264484 59.09 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000523892 (Chr4:148264431..148264485 +)
Downstram Exon
ENSMUSE00000718495 (Chr4:148275814..148275852 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATCTCTAGGACCCCGTGA Chr4:148264465..148264484 59.09 55 AAGATCCATTCTCCGCTCCT Chr4:148275848..148275867 60.18 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000523894 Chr4:148178501..148178623 ACACATTTTTCCCCGGACTT Chr4:148178573..148178592 60.59 45
upstream ENSMUSE00000667185 Chr4:148178538..148178623 ACACATTTTTCCCCGGACTT Chr4:148178573..148178592 60.59 45
upstream ENSMUSE00000523893 Chr4:148212375..148212529 CTTCGGACCTTGGACTCTTG Chr4:148212500..148212519 59.84 55
upstream ENSMUSE00000523892 Chr4:148264431..148264485 GAATCTCTAGGACCCCGTGA Chr4:148264465..148264484 59.09 55

*** Putative Vector Insertion (Chr 4: 148264486 - 148275813) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000715441 Chr4:148275814..148275852 AAGATCCATTCTCCGCTCCT Chr4:148275848..148275867 60.18 50
downstream ENSMUSE00000718495 Chr4:148275814..148275852 AAGATCCATTCTCCGCTCCT Chr4:148275848..148275867 60.18 50
downstream ENSMUSE00000667183 Chr4:148302608..148302623 No primer for this exon
downstream ENSMUSE00000523890 Chr4:148303106..148303591 CTGCATGGTCTTCTTCGTCA Chr4:148303498..148303517 59.98 50
downstream ENSMUSE00000667184 Chr4:148303106..148303591 CTGCATGGTCTTCTTCGTCA Chr4:148303498..148303517 59.98 50
downstream ENSMUSE00000595328 Chr4:148306867..148307701 CCCCGAACGTCGTACTTAGA Chr4:148307503..148307522 60.12 55
downstream ENSMUSE00000630262 Chr4:148306867..148307701 CCCCGAACGTCGTACTTAGA Chr4:148307503..148307522 60.12 55
downstream ENSMUSE00000523888 Chr4:148308690..148308758 ATCTTCGGTGACAGCTGGTT Chr4:148308732..148308751 59.73 50
downstream ENSMUSE00000595327 Chr4:148308690..148308758 ATCTTCGGTGACAGCTGGTT Chr4:148308732..148308751 59.73 50
downstream ENSMUSE00000523887 Chr4:148310275..148310365 TACTGGTAGGCGCAGTGGAT Chr4:148310325..148310344 60.68 55
downstream ENSMUSE00000595326 Chr4:148310275..148310365 TACTGGTAGGCGCAGTGGAT Chr4:148310325..148310344 60.68 55
downstream ENSMUSE00000523886 Chr4:148311068..148311232 GCAGTGGTAGTGGGTGCTCT Chr4:148311229..148311248 60.33 60
downstream ENSMUSE00000595325 Chr4:148311068..148311232 GCAGTGGTAGTGGGTGCTCT Chr4:148311229..148311248 60.33 60
downstream ENSMUSE00000523885 Chr4:148312250..148312422 ATCGTTGATGAGCTGGGTGT Chr4:148312339..148312358 60.54 50
downstream ENSMUSE00000595324 Chr4:148312250..148312422 ATCGTTGATGAGCTGGGTGT Chr4:148312339..148312358 60.54 50
downstream ENSMUSE00000523884 Chr4:148312584..148313431 GAGGTCATCGTTGCTGGATT Chr4:148312923..148312942 60.08 50
downstream ENSMUSE00000595323 Chr4:148312584..148313431 GAGGTCATCGTTGCTGGATT Chr4:148312923..148312942 60.08 50
downstream ENSMUSE00000387510 Chr4:148315391..148315523 GATCCTTCACGGTCAGGTCT Chr4:148315522..148315541 59.1 55
downstream ENSMUSE00000667181 Chr4:148315391..148315523 GATCCTTCACGGTCAGGTCT Chr4:148315522..148315541 59.1 55
downstream ENSMUSE00000327624 Chr4:148315776..148315839 GATGAATTTGCCGAGACTGC Chr4:148315817..148315836 60.75 50
downstream ENSMUSE00000667180 Chr4:148315776..148315839 GATGAATTTGCCGAGACTGC Chr4:148315817..148315836 60.75 50
downstream ENSMUSE00000390222 Chr4:148317012..148317166 CCAAGGCTCTGACAGCTTCT Chr4:148317152..148317171 59.74 55
downstream ENSMUSE00000667179 Chr4:148317012..148317166 CCAAGGCTCTGACAGCTTCT Chr4:148317152..148317171 59.74 55
downstream ENSMUSE00000327610 Chr4:148317312..148317434 ACCGCACTCCTCCACTACAC Chr4:148317396..148317415 60.18 60
downstream ENSMUSE00000184048 Chr4:148318367..148319238 GGGACTCACTTGTCCTGGAA Chr4:148318717..148318736 60.09 55
downstream ENSMUSE00000667178 Chr4:148318367..148318705 CATCTGGGGTATGGTGGAAG Chr4:148318598..148318617 60.19 55
downstream ENSMUSE00000667177 Chr4:148320132..148320330 GTGGAACTTGCTGGCGTATT Chr4:148320180..148320199 60.14 50
downstream ENSMUSE00000667176 Chr4:148321099..148321270 GGTGGTGATGTTGGTGACAA Chr4:148321176..148321195 60.27 50
downstream ENSMUSE00000345076 Chr4:148322633..148322784 TGGCTGTTCACCTGGTTGTA Chr4:148322663..148322682 60.15 50
downstream ENSMUSE00000383862 Chr4:148322902..148323043 CTGTCTCGGCATCCATTAGG Chr4:148322935..148322954 60.62 55
downstream ENSMUSE00000407170 Chr4:148325554..148326680 GCAGTGGTAGTGGGTGACCT Chr4:148325771..148325790 60.03 60
downstream ENSMUSE00000708499 Chr4:148325554..148328998 CTAGCCAGAACCTGGAGTGC Chr4:148328019..148328038 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGACCTGCTCCTGTTCCT Chr4:148264446..148264466 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTTCTCTCCCCGTGACTG Chr4:148264525..148264545 59.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028977