Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31816
Trapped Gene
Ftsj1 (ENSMUSG00000031171)
Vector Insertion
Chr X: 7822185 - 7822557
Public Clones IST10123D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703516 (ChrX:7822410..7822556 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGAATGCTCCATCAACA ChrX:7822463..7822482 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703516 (ChrX:7822410..7822556 -)
Downstram Exon
ENSMUSE00000207058 (ChrX:7822186..7822227 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGAATGCTCCATCAACA ChrX:7822463..7822482 59.65 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000383729 ChrX:7829298..7829532 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000703517 ChrX:7829298..7829436 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000703521 ChrX:7829298..7829521 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000239660 ChrX:7828006..7828163 ACTGAGATGGGACGGACATC ChrX:7828113..7828132 59.93 55
upstream ENSMUSE00000239653 ChrX:7827695..7827764 No primer for this exon
upstream ENSMUSE00000207056 ChrX:7827522..7827612 TACAGGGCGACATCACTCAG ChrX:7827522..7827541 59.85 55
upstream ENSMUSE00000239642 ChrX:7826105..7826183 CCAAGGAGATCATCCAGCAC ChrX:7826154..7826173 60.62 55
upstream ENSMUSE00000207055 ChrX:7823995..7824047 TGGTCTCCATGATGTGGATG ChrX:7824024..7824043 60.34 50
upstream ENSMUSE00000207066 ChrX:7823853..7823906 No primer for this exon
upstream ENSMUSE00000207064 ChrX:7823658..7823760 GGGATGTGACCCTGCTCTAC ChrX:7823728..7823747 59.53 60
upstream ENSMUSE00000207063 ChrX:7823462..7823545 GCTTCATTCCAGACCTGACC ChrX:7823487..7823506 59.66 55
upstream ENSMUSE00000207062 ChrX:7822678..7822781 TCGGACCGCACTTACTCTCT ChrX:7822682..7822701 60.01 55
upstream ENSMUSE00000703520 ChrX:7822678..7822775 TCGGACCGCACTTACTCTCT ChrX:7822682..7822701 60.01 55
upstream ENSMUSE00000343131 ChrX:7822410..7822598 CCAAGAATGCTCCATCAACA ChrX:7822463..7822482 59.65 45
upstream ENSMUSE00000703516 ChrX:7822410..7822556 CCAAGAATGCTCCATCAACA ChrX:7822463..7822482 59.65 45
upstream ENSMUSE00000207058 ChrX:7822186..7822227 No primer for this exon

*** Putative Vector Insertion (Chr X: 7822185 - 7822557) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703519 ChrX:7817546..7817956 GAATTCCTGGGCCTTCTAGG ChrX:7817674..7817693 60.03 55
downstream ENSMUSE00000422171 ChrX:7815794..7817956 TTCAGGCATTTCTTGCTCCT ChrX:7815786..7815805 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACGGTGGCTCTGAGTACAA ChrX:7822574..7822594 58.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATGCGTGACTGGGAAAAC ChrX:7822491..7822511 60.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031171