Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31822
Trapped Gene
Mast1 (ENSMUSG00000053693)
Vector Insertion
Chr 8: 87440054 - 87440659
Public Clones IST14013H6 (tigm) IST13642G7 (tigm) IST13596G2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000468791 (Chr8:87440452..87440658 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAAGTCGGCTTCAGCTACA Chr8:87440477..87440496 59.74 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000468791 (Chr8:87440452..87440658 -)
Downstram Exon
ENSMUSE00000507509 (Chr8:87440055..87440284 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAAGTCGGCTTCAGCTACA Chr8:87440477..87440496 59.74 50 CCCATATTTCTTGCCTGAGC Chr8:87440102..87440121 59.67 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581343 Chr8:87461094..87461252 GCTTTCCAATTTCTCGATGC Chr8:87461134..87461153 59.79 45
upstream ENSMUSE00000717225 Chr8:87461094..87461258 GCTTTCCAATTTCTCGATGC Chr8:87461134..87461153 59.79 45
upstream ENSMUSE00000485663 Chr8:87459605..87459693 GCACTTCTCCGACTCTACCG Chr8:87459636..87459655 60.01 60
upstream ENSMUSE00000581342 Chr8:87459143..87459218 CCCACTTCTCGTTTGCTTCT Chr8:87459151..87459170 59.47 50
upstream ENSMUSE00000262532 Chr8:87454719..87454797 No primer for this exon
upstream ENSMUSE00000262507 Chr8:87453121..87453281 GGACGAGCTGCACTTTCTGT Chr8:87453209..87453228 60.6 55
upstream ENSMUSE00000581341 Chr8:87452849..87452924 CCTCCTCCTACGACAACGAA Chr8:87452891..87452910 60.25 55
upstream ENSMUSE00000517557 Chr8:87452479..87452688 GGCTCATCACCACGGTCTAT Chr8:87452521..87452540 59.96 55
upstream ENSMUSE00000516793 Chr8:87449544..87449645 CTCGGAGAGCTTGGAGGTAG Chr8:87449615..87449634 59.18 60
upstream ENSMUSE00000495053 Chr8:87449308..87449440 ACATCCCCCGATACATCATC Chr8:87449342..87449361 59.44 50
upstream ENSMUSE00000494005 Chr8:87449174..87449241 No primer for this exon
upstream ENSMUSE00000496868 Chr8:87447927..87448012 ATTAGCAATGGTGCCTACGG Chr8:87447927..87447946 59.98 50
upstream ENSMUSE00000417078 Chr8:87447630..87447838 CGCCATGAAGAAGATCAACA Chr8:87447777..87447796 59.8 45
upstream ENSMUSE00000581340 Chr8:87445239..87445377 GAGATGGCGCGAATGTATTT Chr8:87445311..87445330 60.07 45
upstream ENSMUSE00000581339 Chr8:87444999..87445131 ATCAAGCTCACGGATTTTGG Chr8:87445087..87445106 60.07 45
upstream ENSMUSE00000581338 Chr8:87444696..87444861 GTGCCTTTCTTCGGGGATAC Chr8:87444728..87444747 60.83 55
upstream ENSMUSE00000713519 Chr8:87444530..87444615 TAGCCTCTTGCAGACCAACC Chr8:87444535..87444554 60.4 55
upstream ENSMUSE00000417055 Chr8:87444514..87444615 TAGCCTCTTGCAGACCAACC Chr8:87444535..87444554 60.4 55
upstream ENSMUSE00000581337 Chr8:87444259..87444381 TTCTTCCGAGACCTGGACTG Chr8:87444333..87444352 60.38 55
upstream ENSMUSE00000133882 Chr8:87442569..87442678 TCCTATGATGAGGACGACACC Chr8:87442629..87442649 59.94 52.38
upstream ENSMUSE00000417011 Chr8:87441952..87442130 CTCAGCACGAGCCTAAGACC Chr8:87442086..87442105 60.16 60
upstream ENSMUSE00000417006 Chr8:87441626..87441873 CCAAAGAGGCAGTTCAAGGA Chr8:87441660..87441679 60.37 50
upstream ENSMUSE00000468791 Chr8:87440452..87440658 TCAAGTCGGCTTCAGCTACA Chr8:87440477..87440496 59.74 50
upstream ENSMUSE00000507509 Chr8:87440055..87440284 GTGTCTACATGGGCGACTCC Chr8:87440085..87440104 60.54 60

*** Putative Vector Insertion (Chr 8: 87440054 - 87440659) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506540 Chr8:87439579..87439701 CTCTACCACCTCAGGATGCAC Chr8:87439569..87439589 59.74 57.14
downstream ENSMUSE00000262112 Chr8:87439354..87439490 CAATCCGGATGGAAGTGTTT Chr8:87439411..87439430 59.79 45
downstream ENSMUSE00000520050 Chr8:87437219..87437406 GACAAGGACCGGTTCAAAGA Chr8:87437292..87437311 60.09 50
downstream ENSMUSE00000635579 Chr8:87436989..87437140 CGGTACTGGCGGTGTAGTTT Chr8:87436995..87437014 60.05 55
downstream ENSMUSE00000635578 Chr8:87436945..87436986 GTGTGCGCTAGAGGTGACAG Chr8:87436941..87436960 59.65 60
downstream ENSMUSE00000635577 Chr8:87436899..87436943 No primer for this exon
downstream ENSMUSE00000635576 Chr8:87436874..87436897 TAGTTTGGCAGGGAAGCTCT Chr8:87436853..87436872 59.08 50
downstream ENSMUSE00000681388 Chr8:87436858..87436872 No primer for this exon
downstream ENSMUSE00000370543 Chr8:87435885..87436856 CACTGCGGGGTACATTCTTT Chr8:87436009..87436028 59.99 50
downstream ENSMUSE00000714349 Chr8:87435807..87435906 GCAGCATGGGCACTTTATTT Chr8:87435786..87435805 60.1 45
downstream ENSMUSE00000681389 Chr8:87435752..87437140 CACTGCGGGGTACATTCTTT Chr8:87436009..87436028 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:87440589..87440609 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGATGGAGACGTGACTGG Chr8:87440599..87440619 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053693