Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31827
Trapped Gene
Kcnk4 (ENSMUSG00000024957)
Vector Insertion
Chr 19: 7000199 - 7001721
Public Clones IST14803F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000457980 (Chr19:7001581..7001720 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTAGCCTACTTCGCCTCAG Chr19:7001637..7001656 59.24 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000457980 (Chr19:7001581..7001720 -)
Downstram Exon
ENSMUSE00000340982 (Chr19:7000200..7000865 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTAGCCTACTTCGCCTCAG Chr19:7001637..7001656 59.24 60 ACCACGTGGAACAAAAGAGG Chr19:7000341..7000360 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000146623 Chr19:7008838..7009005 CTTCACGTCGACCCTTCTCT Chr19:7008903..7008922 59.45 55
upstream ENSMUSE00000146625 Chr19:7007193..7007458 GACCAGTTTCTGAGGGACCA Chr19:7007233..7007252 60.09 55
upstream ENSMUSE00000695549 Chr19:7007004..7007015 No primer for this exon
upstream ENSMUSE00000146622 Chr19:7002772..7002898 CCAATAGCAGCAACCACTCA Chr19:7002830..7002849 59.86 50
upstream ENSMUSE00000146626 Chr19:7002484..7002644 CGGGCGTCTCTTTTGTATCT Chr19:7002594..7002613 59.34 50
upstream ENSMUSE00000146624 Chr19:7002108..7002294 TGAGAAGTCTGTCCGCAGTG Chr19:7002250..7002269 60.18 55
upstream ENSMUSE00000457980 Chr19:7001581..7001720 CCTAGCCTACTTCGCCTCAG Chr19:7001637..7001656 59.24 60
upstream ENSMUSE00000340982 Chr19:7000200..7000865 CATCGACGAGTCCTCAGACA Chr19:7000598..7000617 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTTCGTGACTGGGAAAAC Chr19:7001655..7001675 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024957