Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31828
Trapped Gene
Ubqln4 (ENSMUSG00000008604)
Vector Insertion
Chr 3: 88369800 - 88372002
Public Clones 3SE171F11 (ggtc) (ggtc) 5SE171F11 (ggtc) (ggtc) (cmhd)
IST11167G12 (tigm) IST11284E1 (tigm) IST11290D3 (tigm) IST11636C8 (tigm)
IST11721E11 (tigm) IST10245D11 (tigm) IST11972F11 (tigm) IST11066E6 (tigm)
IST11167G12 (tigm) IST10280G2 (tigm) IST11971F11 (tigm) IST10851F2 (tigm)
IST11721E11 (tigm) IST15051G10 (tigm) IST11066E6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175591 (Chr3:88369613..88369799 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175591 (Chr3:88369613..88369799 +)
Downstram Exon
ENSMUSE00000347364 (Chr3:88372003..88373647 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398215 Chr3:88357638..88357834 No primer for this exon
upstream ENSMUSE00000175593 Chr3:88359260..88359411 No primer for this exon
upstream ENSMUSE00000175597 Chr3:88359712..88359914 No primer for this exon
upstream ENSMUSE00000175594 Chr3:88360579..88360841 No primer for this exon
upstream ENSMUSE00000175601 Chr3:88363540..88363698 No primer for this exon
upstream ENSMUSE00000175600 Chr3:88367030..88367255 No primer for this exon
upstream ENSMUSE00000175596 Chr3:88368292..88368431 No primer for this exon
upstream ENSMUSE00000175599 Chr3:88368929..88369012 No primer for this exon
upstream ENSMUSE00000175598 Chr3:88369135..88369250 No primer for this exon
upstream ENSMUSE00000175591 Chr3:88369613..88369799 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88369800 - 88372002) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000347364 Chr3:88372003..88373647 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGCAGGGGCAGTACATA Chr3:88369833..88369853 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAACTTTTGTCCGGAAGTG Chr3:88369770..88369790 60.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008604