Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31840
Trapped Gene
Nudt15 (ENSMUSG00000033405)
Vector Insertion
Chr 14: 73923104 - 73925124
Public Clones IST11376H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411578 (Chr14:73924867..73925123 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAACACTCAGCGAGCAAT Chr14:73925084..73925103 60.06 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411578 (Chr14:73924867..73925123 -)
Downstram Exon
ENSMUSE00000257555 (Chr14:73923105..73923301 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAACACTCAGCGAGCAAT Chr14:73925084..73925103 60.06 50 CTCTCTGAGCGCATTCTTCC Chr14:73923251..73923270 60.24 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000378674 Chr14:73947841..73948049 TTCAGTGGGACCTGAAGACC Chr14:73947854..73947873 60.09 55
upstream ENSMUSE00000364256 Chr14:73931875..73931992 CCAGACCTCAAAGAGGCATT Chr14:73931918..73931937 59.28 50
upstream ENSMUSE00000411578 Chr14:73924867..73925123 CACAACACTCAGCGAGCAAT Chr14:73925084..73925103 60.06 50
upstream ENSMUSE00000257555 Chr14:73923105..73923301 TTTGCCTCCGTGGTAAATTC Chr14:73923212..73923231 59.94 45

*** Putative Vector Insertion (Chr 14: 73923104 - 73925124) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000357022 Chr14:73919671..73921481 CTATGCTGTGCCTGACCAGA Chr14:73920375..73920394 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAACACTCAGCGAGCAATC Chr14:73925081..73925101 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033405