Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31842
Trapped Gene
Etl4 (ENSMUSG00000036617)
Vector Insertion
Chr 2: 20261737 - 20431673
Public Clones (sanger) (sanger) (sanger) (ggtc) IST10292G4 (tigm) IST13103D12 (tigm)
IST10843H5 (tigm) IST11009C12 (tigm) IST10292G4 (tigm) IST13986E2 (tigm)
IST11040B8 (tigm) IST14410F9 (tigm) IST10785B1 (tigm) IST11418E11 (tigm)
IST10324H7 (tigm) IST11759H12 (tigm) IST14803H11 (tigm) IST11656A1 (tigm)
IST11534F11 (tigm) IST10785B1 (tigm) IST11107G9 (tigm) IST10427D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699971 (Chr2:20261523..20261736 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAGAAAACCAGCCGAGGT Chr2:20261614..20261633 60.25 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699971 (Chr2:20261523..20261736 +)
Downstram Exon
ENSMUSE00000410886 (Chr2:20431674..20431886 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAGAAAACCAGCCGAGGT Chr2:20261614..20261633 60.25 50 TGGCCTCTAAGTTTGCCTTG Chr2:20431716..20431735 60.38 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699940 Chr2:19831407..19831906 CTCTTGCCACCGAAAGACTC Chr2:19831746..19831765 59.99 55
upstream ENSMUSE00000699939 Chr2:20038600..20038680 CTGGACCCTGTGTTTGACATC Chr2:20038610..20038630 60.42 52.38
upstream ENSMUSE00000699938 Chr2:20211521..20211668 AAAGTCGCCCTCAAAGGATT Chr2:20211603..20211622 60.07 45
upstream ENSMUSE00000699998 Chr2:20211540..20211668 AAAGTCGCCCTCAAAGGATT Chr2:20211603..20211622 60.07 45
upstream ENSMUSE00000699971 Chr2:20261523..20261736 AGAAGAAAACCAGCCGAGGT Chr2:20261614..20261633 60.25 50
upstream ENSMUSE00000699995 Chr2:20261549..20261736 AGAAGAAAACCAGCCGAGGT Chr2:20261614..20261633 60.25 50

*** Putative Vector Insertion (Chr 2: 20261737 - 20431673) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000410886 Chr2:20431674..20431886 TGGCCTCTAAGTTTGCCTTG Chr2:20431716..20431735 60.38 50
downstream ENSMUSE00000708489 Chr2:20441140..20441554 CAGGTTCGGCTCACATTTCT Chr2:20441526..20441545 60.26 50
downstream ENSMUSE00000717316 Chr2:20441140..20441554 CAGGTTCGGCTCACATTTCT Chr2:20441526..20441545 60.26 50
downstream ENSMUSE00000721391 Chr2:20441140..20441554 CAGGTTCGGCTCACATTTCT Chr2:20441526..20441545 60.26 50
downstream ENSMUSE00000647336 Chr2:20441455..20441554 CAGGTTCGGCTCACATTTCT Chr2:20441526..20441545 60.26 50
downstream ENSMUSE00000423589 Chr2:20451586..20451869 CATGCTGCATCTTCCTGAGA Chr2:20451637..20451656 60.1 50
downstream ENSMUSE00000715347 Chr2:20451586..20451869 CATGCTGCATCTTCCTGAGA Chr2:20451637..20451656 60.1 50
downstream ENSMUSE00000716425 Chr2:20451586..20451869 CATGCTGCATCTTCCTGAGA Chr2:20451637..20451656 60.1 50
downstream ENSMUSE00000699932 Chr2:20583525..20583723 TACTTCTCCCTCGGACATGG Chr2:20583641..20583660 60.06 55
downstream ENSMUSE00000713171 Chr2:20583525..20583723 TACTTCTCCCTCGGACATGG Chr2:20583641..20583660 60.06 55
downstream ENSMUSE00000717687 Chr2:20583525..20583723 TACTTCTCCCTCGGACATGG Chr2:20583641..20583660 60.06 55
downstream ENSMUSE00000410192 Chr2:20631032..20631230 GGAAAGGCACTGACGAAGAG Chr2:20631137..20631156 59.99 55
downstream ENSMUSE00000699967 Chr2:20631032..20631230 GGAAAGGCACTGACGAAGAG Chr2:20631137..20631156 59.99 55
downstream ENSMUSE00000272760 Chr2:20634982..20635075 GGCTTTCGTCATGTGGTTAAA Chr2:20635059..20635079 59.99 42.86
downstream ENSMUSE00000699966 Chr2:20634982..20635075 GGCTTTCGTCATGTGGTTAAA Chr2:20635059..20635079 59.99 42.86
downstream ENSMUSE00000699927 Chr2:20644252..20644350 TTCCAGACTCGCAGAGACCT Chr2:20644314..20644333 60.13 55
downstream ENSMUSE00000699929 Chr2:20658941..20659182 TTTGTTTTGACCCGGTCTTC Chr2:20658985..20659004 59.95 45
downstream ENSMUSE00000647337 Chr2:20665086..20665918 TGTCTTCATCCGGTTTGACA Chr2:20665377..20665396 60.09 45
downstream ENSMUSE00000699935 Chr2:20665086..20666443 ACCTGAACCCACTCATCCAG Chr2:20666064..20666083 59.96 55
downstream ENSMUSE00000709622 Chr2:20665086..20665918 TGTCTTCATCCGGTTTGACA Chr2:20665377..20665396 60.09 45
downstream ENSMUSE00000712334 Chr2:20665086..20665918 TGTCTTCATCCGGTTTGACA Chr2:20665377..20665396 60.09 45
downstream ENSMUSE00000647335 Chr2:20681174..20681278 CTGGCAATCTGCTTCTCCAT Chr2:20681212..20681231 60.36 50
downstream ENSMUSE00000423086 Chr2:20681842..20681891 GCTGTGGCTTTCACCATTTT Chr2:20681868..20681887 60.12 45
downstream ENSMUSE00000699964 Chr2:20681842..20681891 GCTGTGGCTTTCACCATTTT Chr2:20681868..20681887 60.12 45
downstream ENSMUSE00000423066 Chr2:20688072..20688238 TGTCAAGCAGGCTAGTGTGG Chr2:20688185..20688204 60.05 55
downstream ENSMUSE00000699963 Chr2:20688072..20688238 TGTCAAGCAGGCTAGTGTGG Chr2:20688185..20688204 60.05 55
downstream ENSMUSE00000699924 Chr2:20688199..20688238 TGGAGTTGGAGCCTGAGTTC Chr2:20688222..20688241 60.39 55
downstream ENSMUSE00000423064 Chr2:20699653..20699828 ACAATCCGCTCTTCTTCGTG Chr2:20699819..20699838 60.4 50
downstream ENSMUSE00000699962 Chr2:20699653..20699828 ACAATCCGCTCTTCTTCGTG Chr2:20699819..20699838 60.4 50
downstream ENSMUSE00000423061 Chr2:20702569..20702699 ACTCTGCCAGTGGAGGAAGA Chr2:20702628..20702647 59.99 55
downstream ENSMUSE00000699959 Chr2:20702569..20702699 ACTCTGCCAGTGGAGGAAGA Chr2:20702628..20702647 59.99 55
downstream ENSMUSE00000423058 Chr2:20703425..20703572 CAACTTCTATGCGCAGGACA Chr2:20703481..20703500 60.01 50
downstream ENSMUSE00000699958 Chr2:20703425..20703572 CAACTTCTATGCGCAGGACA Chr2:20703481..20703500 60.01 50
downstream ENSMUSE00000383856 Chr2:20706671..20707127 ACCATTCACTGGGGTCTGAG Chr2:20707058..20707077 59.96 55
downstream ENSMUSE00000699923 Chr2:20706671..20707127 ACCATTCACTGGGGTCTGAG Chr2:20707058..20707077 59.96 55
downstream ENSMUSE00000699944 Chr2:20706671..20707094 ACCATTCACTGGGGTCTGAG Chr2:20707058..20707077 59.96 55
downstream ENSMUSE00000699957 Chr2:20706671..20706862 GATAGGGGCACCACTTCTGA Chr2:20706859..20706878 60.07 55
downstream ENSMUSE00000272689 Chr2:20710055..20710238 GCATCTCCCTTTGACACTGG Chr2:20710215..20710234 60.66 55
downstream ENSMUSE00000699919 Chr2:20710055..20710238 GCATCTCCCTTTGACACTGG Chr2:20710215..20710234 60.66 55
downstream ENSMUSE00000272683 Chr2:20719504..20719658 AGACCACATCGCCTGATCTC Chr2:20719638..20719657 60.23 55
downstream ENSMUSE00000647334 Chr2:20719504..20719658 AGACCACATCGCCTGATCTC Chr2:20719638..20719657 60.23 55
downstream ENSMUSE00000343104 Chr2:20720243..20720410 GGGGACATTTTGTGGCTCTA Chr2:20720300..20720319 59.93 50
downstream ENSMUSE00000521501 Chr2:20723169..20723288 CTGTTAGCTCGGGACTGCTC Chr2:20723239..20723258 60.16 60
downstream ENSMUSE00000647331 Chr2:20727212..20727289 GGGCCATTTTCACATTCAAC Chr2:20727273..20727292 60.18 45
downstream ENSMUSE00000647330 Chr2:20727402..20729000 TCGGACTCCAGAGTCTTCGT Chr2:20728283..20728302 59.99 55
downstream ENSMUSE00000345647 Chr2:20729529..20729651 CCTGTAGTTTGGACTGCTTGC Chr2:20729633..20729653 59.93 52.38
downstream ENSMUSE00000699925 Chr2:20729529..20731981 CTGGCGAGGCTAGGAGTATG Chr2:20730776..20730795 59.99 60
downstream ENSMUSE00000699926 Chr2:20729529..20729817 CCTGTAGTTTGGACTGCTTGC Chr2:20729633..20729653 59.93 52.38
downstream ENSMUSE00000699956 Chr2:20729573..20729651 CCTGTAGTTTGGACTGCTTGC Chr2:20729633..20729653 59.93 52.38
downstream ENSMUSE00000391727 Chr2:20730337..20732151 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000647329 Chr2:20730337..20731980 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000699928 Chr2:20730337..20732340 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000699942 Chr2:20730337..20732163 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000699954 Chr2:20730337..20732151 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000699974 Chr2:20730337..20732162 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCATGAACCTAGACTTGTG Chr2:20279719..20279740 59.61 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAAACCCACACTGAGAGG Chr2:20279768..20279788 59.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036617