Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31852
Trapped Gene
Ttyh1 (ENSMUSG00000030428)
Vector Insertion
Chr 7: 4074258 - 4076105
Public Clones IST11030A1 (tigm) IST12716G11 (tigm) IST13102F2 (tigm) IST12407H9 (tigm)
IST13579D12 (tigm) IST11030A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307058 (Chr7:4074079..4074257 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTCATCTTCATCGCTGT Chr7:4074124..4074143 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307058 (Chr7:4074079..4074257 +)
Downstram Exon
ENSMUSE00000677315 (Chr7:4076106..4076122 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTCATCTTCATCGCTGT Chr7:4074124..4074143 59.98 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000538783 Chr7:4071132..4071382 GCGACCAAGAGTACCAGCAG Chr7:4071363..4071382 61 60
upstream ENSMUSE00000713039 Chr7:4071132..4071382 GCGACCAAGAGTACCAGCAG Chr7:4071363..4071382 61 60
upstream ENSMUSE00000538755 Chr7:4071188..4071382 GCGACCAAGAGTACCAGCAG Chr7:4071363..4071382 61 60
upstream ENSMUSE00000705978 Chr7:4071251..4071382 GCGACCAAGAGTACCAGCAG Chr7:4071363..4071382 61 60
upstream ENSMUSE00000307058 Chr7:4074079..4074257 AGCCTCATCTTCATCGCTGT Chr7:4074124..4074143 59.98 50

*** Putative Vector Insertion (Chr 7: 4074258 - 4076105) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000677315 Chr7:4076106..4076122 No primer for this exon
downstream ENSMUSE00000307053 Chr7:4076222..4076333 ATCGCTGGTCTCGCTGTTAC Chr7:4076270..4076289 60.43 55
downstream ENSMUSE00000198761 Chr7:4077125..4077345 TTGCAGGTACTGAGCAGCAG Chr7:4077271..4077290 60.35 55
downstream ENSMUSE00000198762 Chr7:4079772..4079867 ACCAGAAGCACCAAGAGCAG Chr7:4079816..4079835 60.59 55
downstream ENSMUSE00000198766 Chr7:4080903..4080975 CATAGAACCCCAGCTCAGGA Chr7:4080954..4080973 60.21 55
downstream ENSMUSE00000198764 Chr7:4081260..4081335 TGGGTCAGGTTCAGCACATA Chr7:4081315..4081334 60.11 50
downstream ENSMUSE00000198763 Chr7:4082183..4082238 GCCTGGTTGCACAGGAAATA Chr7:4082219..4082238 61.03 50
downstream ENSMUSE00000198771 Chr7:4082399..4082491 GTGGATGCTGGCTAGAGCAC Chr7:4082440..4082459 60.98 60
downstream ENSMUSE00000198767 Chr7:4082893..4082985 No primer for this exon
downstream ENSMUSE00000198765 Chr7:4084677..4084819 TAGGCCCTCTAGGGCATCTT Chr7:4084730..4084749 60.19 55
downstream ENSMUSE00000198759 Chr7:4084959..4085004 GGTTGAAAGGGTCATCGTCA Chr7:4085002..4085021 60.9 50
downstream ENSMUSE00000198769 Chr7:4085265..4085340 AGGCTCAGATGGAAGACTGC Chr7:4085310..4085329 59.56 55
downstream ENSMUSE00000538751 Chr7:4085265..4085328 AGGCTCAGATGGAAGACTGC Chr7:4085310..4085329 59.56 55
downstream ENSMUSE00000601331 Chr7:4085265..4085340 AGGCTCAGATGGAAGACTGC Chr7:4085310..4085329 59.56 55
downstream ENSMUSE00000637655 Chr7:4085330..4085340 No primer for this exon
downstream ENSMUSE00000306995 Chr7:4085468..4086947 CTGTACCTGCCTCCAGCTTC Chr7:4085749..4085768 60.01 60
downstream ENSMUSE00000538756 Chr7:4085468..4085501 No primer for this exon
downstream ENSMUSE00000601333 Chr7:4085468..4086460 CTGTACCTGCCTCCAGCTTC Chr7:4085749..4085768 60.01 60
downstream ENSMUSE00000714405 Chr7:4085953..4086932 CAAGTTGATTCCACGCCTTT Chr7:4086140..4086159 60.11 45
downstream ENSMUSE00000538766 Chr7:4086172..4086258 CTGGTGGCACTACAAGCAAA Chr7:4086251..4086270 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTAATCGCCTTGCAGCAC Chr7:4074306..4074326 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTCTCGTGGGCTGGTAAT Chr7:4074244..4074264 61.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030428