Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31861
Trapped Gene
Stxbp4 (ENSMUSG00000020546)
Vector Insertion
Chr 11: 90483505 - 90499380
Public Clones IST14295D12 (tigm) IST13200C2 (tigm) IST13549D1 (tigm) IST14308B10 (tigm)
IST14890B11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674658 (Chr11:90499347..90499379 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674658 (Chr11:90499347..90499379 -)
Downstram Exon
ENSMUSE00000106384 (Chr11:90483506..90483575 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000312834 Chr11:90499347..90499398 No primer for this exon
upstream ENSMUSE00000674653 Chr11:90499347..90499390 No primer for this exon
upstream ENSMUSE00000674658 Chr11:90499347..90499379 No primer for this exon
upstream ENSMUSE00000106384 Chr11:90483506..90483575 No primer for this exon

*** Putative Vector Insertion (Chr 11: 90483505 - 90499380) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000106371 Chr11:90482969..90483096 No primer for this exon
downstream ENSMUSE00000718765 Chr11:90482969..90483096 No primer for this exon
downstream ENSMUSE00000106413 Chr11:90480497..90480629 No primer for this exon
downstream ENSMUSE00000106394 Chr11:90468659..90468765 No primer for this exon
downstream ENSMUSE00000106386 Chr11:90468282..90468498 No primer for this exon
downstream ENSMUSE00000674655 Chr11:90467271..90467345 No primer for this exon
downstream ENSMUSE00000106375 Chr11:90467267..90467345 No primer for this exon
downstream ENSMUSE00000674654 Chr11:90466091..90466192 No primer for this exon
downstream ENSMUSE00000674652 Chr11:90464438..90466188 No primer for this exon
downstream ENSMUSE00000106385 Chr11:90461500..90461594 No primer for this exon
downstream ENSMUSE00000674656 Chr11:90460702..90461594 No primer for this exon
downstream ENSMUSE00000106389 Chr11:90456059..90456155 No primer for this exon
downstream ENSMUSE00000106388 Chr11:90453646..90453737 No primer for this exon
downstream ENSMUSE00000106381 Chr11:90436564..90436653 No primer for this exon
downstream ENSMUSE00000106404 Chr11:90433036..90433101 No primer for this exon
downstream ENSMUSE00000312770 Chr11:90410125..90410301 No primer for this exon
downstream ENSMUSE00000106395 Chr11:90401480..90401596 No primer for this exon
downstream ENSMUSE00000106390 Chr11:90399225..90399274 No primer for this exon
downstream ENSMUSE00000106402 Chr11:90396794..90396927 No primer for this exon
downstream ENSMUSE00000106387 Chr11:90355916..90355973 No primer for this exon
downstream ENSMUSE00000497332 Chr11:90341250..90342028 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGTTGAGAAGTTGAGCA Chr11:90493344..90493364 59.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGTTGAGAAGTTGAGCA Chr11:90493344..90493364 59.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020546