Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31864
Trapped Gene
Rsrc1 (ENSMUSG00000034544)
Vector Insertion
Chr 3: 66886632 - 66984750
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) IST14038B7 (tigm)
IST10871D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639027 (Chr3:66886458..66886631 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGTAAAGTCCGGGACAAA Chr3:66886550..66886569 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639027 (Chr3:66886458..66886631 +)
Downstram Exon
ENSMUSE00000639026 (Chr3:66984751..66984787 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGTAAAGTCCGGGACAAA Chr3:66886550..66886569 59.97 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639029 Chr3:66789594..66789728 AAGGCGCTGAGCTTAAATTG Chr3:66789617..66789636 59.63 45
upstream ENSMUSE00000450685 Chr3:66789891..66790011 GCTTGGCCTACAGTGTGGAG Chr3:66789979..66789998 60.85 60
upstream ENSMUSE00000500105 Chr3:66798439..66798634 AGCTTCGCTCGCATTCTTAT Chr3:66798607..66798626 59.23 45
upstream ENSMUSE00000639028 Chr3:66798439..66798634 AGCTTCGCTCGCATTCTTAT Chr3:66798607..66798626 59.23 45
upstream ENSMUSE00000232676 Chr3:66800387..66800512 AAGGTCTCGGTCAAAAAGCA Chr3:66800483..66800502 59.85 45
upstream ENSMUSE00000639027 Chr3:66886458..66886631 GACGTAAAGTCCGGGACAAA Chr3:66886550..66886569 59.97 50

*** Putative Vector Insertion (Chr 3: 66886632 - 66984750) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639026 Chr3:66984751..66984787 No primer for this exon
downstream ENSMUSE00000639025 Chr3:67010348..67010399 GCTTCAAGGACCAATTGCAG Chr3:67010397..67010416 60.78 50
downstream ENSMUSE00000639024 Chr3:67094269..67094337 No primer for this exon
downstream ENSMUSE00000639023 Chr3:67153831..67153937 TGTTCTACCAGGGTGGCTTG Chr3:67153855..67153874 61.08 55
downstream ENSMUSE00000450607 Chr3:67155618..67155674 CCATCATGTCTTCCCAGGAC Chr3:67155640..67155659 60.33 55
downstream ENSMUSE00000639022 Chr3:67159396..67159548 ACATGCTGCACTTCACTTGG Chr3:67159427..67159446 59.9 50
downstream ENSMUSE00000639021 Chr3:67160143..67162325 GTCTCTTTGCTTCCCGACAG Chr3:67161167..67161186 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:66919682..66919702 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTTCGTGACTGGGAAAAC Chr3:66946678..66946698 58.05 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034544