Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31869
Trapped Gene
Cbfa2t3 (ENSMUSG00000006362)
Vector Insertion
Chr 8: 125158848 - 125159731
Public Clones IST11059D7 (tigm) IST11059D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000633927 (Chr8:125159710..125159730 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000633927 (Chr8:125159710..125159730 -)
Downstram Exon
ENSMUSE00000579506 (Chr8:125158849..125159047 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000579514 Chr8:125222715..125222793 No primer for this exon
upstream ENSMUSE00000605730 Chr8:125201762..125202075 No primer for this exon
upstream ENSMUSE00000579497 Chr8:125174230..125174376 No primer for this exon
upstream ENSMUSE00000579513 Chr8:125174230..125174376 No primer for this exon
upstream ENSMUSE00000215132 Chr8:125171601..125171678 No primer for this exon
upstream ENSMUSE00000579511 Chr8:125167192..125167433 No primer for this exon
upstream ENSMUSE00000579510 Chr8:125166864..125166953 No primer for this exon
upstream ENSMUSE00000579509 Chr8:125162757..125162938 No primer for this exon
upstream ENSMUSE00000678350 Chr8:125161894..125162123 No primer for this exon
upstream ENSMUSE00000678347 Chr8:125159732..125159739 No primer for this exon
upstream ENSMUSE00000633927 Chr8:125159710..125159730 No primer for this exon
upstream ENSMUSE00000579507 Chr8:125159654..125159739 No primer for this exon
upstream ENSMUSE00000579506 Chr8:125158849..125159047 No primer for this exon

*** Putative Vector Insertion (Chr 8: 125158848 - 125159731) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000579504 Chr8:125158260..125158328 No primer for this exon
downstream ENSMUSE00000579498 Chr8:125157218..125157408 No primer for this exon
downstream ENSMUSE00000295415 Chr8:125153838..125154876 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCACAGAACGCGAGTGTA Chr8:125159678..125159698 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000006362