Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31871
Trapped Gene
Vsig2 (ENSMUSG00000001943)
Vector Insertion
Chr 9: 37349071 - 37349939
Public Clones IST11075B7 (tigm) IST11075B7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000216891 (Chr9:37348912..37349070 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000216891 (Chr9:37348912..37349070 +)
Downstram Exon
ENSMUSE00000330356 (Chr9:37349940..37350059 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701488 Chr9:37346840..37347023 No primer for this exon
upstream ENSMUSE00000216880 Chr9:37347454..37347611 No primer for this exon
upstream ENSMUSE00000501005 Chr9:37347879..37348086 No primer for this exon
upstream ENSMUSE00000701485 Chr9:37347961..37348086 No primer for this exon
upstream ENSMUSE00000216891 Chr9:37348912..37349070 No primer for this exon

*** Putative Vector Insertion (Chr 9: 37349071 - 37349939) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000330356 Chr9:37349940..37350059 No primer for this exon
downstream ENSMUSE00000330336 Chr9:37350174..37350318 No primer for this exon
downstream ENSMUSE00000373970 Chr9:37351595..37351790 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCTGGTTAATCGCCTTGC Chr9:37349114..37349134 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTACAGGGCATTGGGAAGA Chr9:37349077..37349097 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001943