Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31879
Trapped Gene
Abhd6 (ENSMUSG00000025277)
Vector Insertion
Chr 14: 8873747 - 8875207
Public Clones IST12781H8 (tigm) IST14814D3 (tigm) IST13455D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000149485 (Chr14:8873633..8873746 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCCATAGTGGGGCAAGTT Chr14:8873712..8873731 60.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000149485 (Chr14:8873633..8873746 +)
Downstram Exon
ENSMUSE00000149483 (Chr14:8875208..8875340 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCCATAGTGGGGCAAGTT Chr14:8873712..8873731 60.38 50 AGCAGGACACACGAGAGACA Chr14:8875342..8875361 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000350253 Chr14:8835457..8835477 No primer for this exon
upstream ENSMUSE00000390530 Chr14:8860751..8860903 CAGGTGTCAACAAGGCTCAA Chr14:8860757..8860776 59.87 50
upstream ENSMUSE00000306381 Chr14:8872262..8872418 GACACAAGCCATCCATCCTT Chr14:8872348..8872367 59.93 50
upstream ENSMUSE00000149485 Chr14:8873633..8873746 TGTCCATAGTGGGGCAAGTT Chr14:8873712..8873731 60.38 50

*** Putative Vector Insertion (Chr 14: 8873747 - 8875207) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000149483 Chr14:8875208..8875340 AGCAGGACACACGAGAGACA Chr14:8875342..8875361 59.6 55
downstream ENSMUSE00000149487 Chr14:8877982..8878139 CCTTGAAGCGGACATAGGAG Chr14:8878131..8878150 59.83 55
downstream ENSMUSE00000149484 Chr14:8882088..8882142 GAATGCGAACATCGACAAGA Chr14:8882121..8882140 59.81 45
downstream ENSMUSE00000149480 Chr14:8882322..8882422 CTGTGTCGGGACCTTGATCT Chr14:8882401..8882420 60.11 55
downstream ENSMUSE00000149481 Chr14:8887985..8888423 CTACCGAATGGCCACAGTTT Chr14:8888075..8888094 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCCATAGTGGGGCAAGTT Chr14:8873713..8873733 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCCATAGTGGGGCAAGTT Chr14:8873713..8873733 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025277