Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3188
Trapped Gene
Phf21a (ENSMUSG00000058318)
Vector Insertion
Chr 2: 92061626 - 92061773
Public Clones XR0684 (sanger) AB0058 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715490 (Chr2:92061627..92061772 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACGGAGGCTGAAGACACTG Chr2:92061659..92061678 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715490 (Chr2:92061627..92061772 +)
Downstram Exon
ENSMUSE00000710902 (Chr2:92061627..92061772 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACGGAGGCTGAAGACACTG Chr2:92061659..92061678 60.44 55 GCCTTCTCCACGCTCTCTTA Chr2:92061716..92061735 59.72 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687386 Chr2:91933274..91933310 AAAAACTGAGCCCACTACCTCA Chr2:91933287..91933308 60.17 45.46
upstream ENSMUSE00000642532 Chr2:92024263..92024509 CCCTCCCCATGAAGAAGAGT Chr2:92024406..92024425 60.45 55
upstream ENSMUSE00000687368 Chr2:92024364..92024509 CCCTCCCCATGAAGAAGAGT Chr2:92024406..92024425 60.45 55
upstream ENSMUSE00000687365 Chr2:92024433..92024509 CTCAGAGTTCCTGCCTCCAG Chr2:92024456..92024475 60.13 60
upstream ENSMUSE00000687364 Chr2:92025640..92025745 TCTCTCTTCGCTCGCTCTCT Chr2:92025682..92025701 59.73 55
upstream ENSMUSE00000687363 Chr2:92026708..92026766 No primer for this exon
upstream ENSMUSE00000687372 Chr2:92054206..92054246 GGACTGGAGAGCTGAAGGAG Chr2:92054207..92054226 59.13 60
upstream ENSMUSE00000687367 Chr2:92055621..92055732 AGGGAGCCCACTACCTCATAA Chr2:92055711..92055731 59.97 52.38

*** Putative Vector Insertion (Chr 2: 92061626 - 92061773) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000710902 Chr2:92061627..92061772 GCCTTCTCCACGCTCTCTTA Chr2:92061716..92061735 59.72 55
downstream ENSMUSE00000715490 Chr2:92061627..92061772 GCCTTCTCCACGCTCTCTTA Chr2:92061716..92061735 59.72 55
downstream ENSMUSE00000687371 Chr2:92061629..92061772 GCCTTCTCCACGCTCTCTTA Chr2:92061716..92061735 59.72 55
downstream ENSMUSE00000599875 Chr2:92068606..92068638 TTCATTTGGGCAACCAGTTT Chr2:92068628..92068647 60.34 40
downstream ENSMUSE00000710004 Chr2:92068606..92068638 TTCATTTGGGCAACCAGTTT Chr2:92068628..92068647 60.34 40
downstream ENSMUSE00000717571 Chr2:92068606..92068638 TTCATTTGGGCAACCAGTTT Chr2:92068628..92068647 60.34 40
downstream ENSMUSE00000599874 Chr2:92070816..92070881 TGATTTTGGCTTGGAGTTCA Chr2:92070864..92070883 59.25 40
downstream ENSMUSE00000687353 Chr2:92070816..92070881 TGATTTTGGCTTGGAGTTCA Chr2:92070864..92070883 59.25 40
downstream ENSMUSE00000599873 Chr2:92160386..92160616 TTAGACTAGGCGGTGCTGCT Chr2:92160608..92160627 60.18 55
downstream ENSMUSE00000687352 Chr2:92160386..92160616 TTAGACTAGGCGGTGCTGCT Chr2:92160608..92160627 60.18 55
downstream ENSMUSE00000565030 Chr2:92167070..92167321 CCACAATTTGGACAGCCTCT Chr2:92167304..92167323 60.11 50
downstream ENSMUSE00000687358 Chr2:92167073..92167321 ACAATTTGGACAGCCTCTGC Chr2:92167302..92167321 60.26 50
downstream ENSMUSE00000299255 Chr2:92168469..92168558 GAGGAGGTGTTGCTTGAACC Chr2:92168493..92168512 59.7 55
downstream ENSMUSE00000447288 Chr2:92168472..92168558 GGCGTGGAGTGAGTCTAGGA Chr2:92168544..92168563 60.41 60
downstream ENSMUSE00000687351 Chr2:92168472..92168558 GGCGTGGAGTGAGTCTAGGA Chr2:92168544..92168563 60.41 60
downstream ENSMUSE00000599867 Chr2:92170672..92170965 AACGTTTTGGCTATGGTTGC Chr2:92170868..92170887 60 45
downstream ENSMUSE00000599872 Chr2:92170672..92170965 AACGTTTTGGCTATGGTTGC Chr2:92170868..92170887 60 45
downstream ENSMUSE00000299242 Chr2:92184701..92184799 TAACGGTACGGCTCTCTGCT Chr2:92184758..92184777 60.04 55
downstream ENSMUSE00000564996 Chr2:92184701..92184739 CTGCTTCTGGGTGGGATTTA Chr2:92184728..92184747 60.07 50
downstream ENSMUSE00000565025 Chr2:92184705..92184741 CTGCTTCTGGGTGGGATTTA Chr2:92184728..92184747 60.07 50
downstream ENSMUSE00000299234 Chr2:92188153..92188204 CCAACCCTAGAGACACCATGA Chr2:92188185..92188205 59.97 52.38
downstream ENSMUSE00000643195 Chr2:92188178..92188204 No primer for this exon
downstream ENSMUSE00000299225 Chr2:92189035..92189114 AGACAGCCCCACTGTACACC Chr2:92189106..92189125 60.03 60
downstream ENSMUSE00000299219 Chr2:92189545..92189605 No primer for this exon
downstream ENSMUSE00000299209 Chr2:92191766..92191788 CTTTGGCCAGTGTTCCTCAT Chr2:92191791..92191810 60.11 50
downstream ENSMUSE00000447225 Chr2:92191858..92192021 CAGGTGCAGGGAAAGTGAAT Chr2:92191986..92192005 60.11 50
downstream ENSMUSE00000687356 Chr2:92191989..92192021 No primer for this exon
downstream ENSMUSE00000299203 Chr2:92197021..92197176 CACGTGTCACACATCAGCAA Chr2:92197091..92197110 60.37 50
downstream ENSMUSE00000299198 Chr2:92198851..92198926 TGCTTTGTAGGCGATGTAGG Chr2:92198928..92198947 58.94 50
downstream ENSMUSE00000299191 Chr2:92199263..92199366 TTGTTCCCGCTCCTGTTTTA Chr2:92199330..92199349 60.61 45
downstream ENSMUSE00000643191 Chr2:92200326..92201050 AAACGGCTCCCAGTAAGGAT Chr2:92200981..92201000 59.96 50
downstream ENSMUSE00000687362 Chr2:92200326..92201058 AAACGGCTCCCAGTAAGGAT Chr2:92200981..92201000 59.96 50
downstream ENSMUSE00000687366 Chr2:92200326..92204822 CTTGAAGGACGTCATCAGCA Chr2:92203836..92203855 59.98 50
downstream ENSMUSE00000687369 Chr2:92200326..92201986 AAACGGCTCCCAGTAAGGAT Chr2:92200981..92201000 59.96 50
downstream ENSMUSE00000564995 Chr2:92200951..92201046 AAACGGCTCCCAGTAAGGAT Chr2:92200981..92201000 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:92061676..92061696 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACGTGACTGGGAAAACC Chr2:92061673..92061693 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058318