Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31884
Trapped Gene
AC171681.1 (ENSMUSG00000079357)
Vector Insertion
Chr 14: 14751083 - 14754050
Public Clones IST12436G1 (tigm) IST13239D11 (tigm) IST13830A1 (tigm) IST10783B5 (tigm)
IST12247C10 (tigm) IST10513H1 (tigm) IST13685B4 (tigm) IST14433E11 (tigm)
IST14251B7 (tigm) IST12969B5 (tigm) IST10301C12 (tigm) IST13919D8 (tigm)
IST12799C5 (tigm) IST13410G12 (tigm) IST13436C5 (tigm) IST13353C3 (tigm)
IST13171C6 (tigm) IST10204G4 (tigm) IST10372C3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692569 (Chr14:14750958..14751082 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCTAAAGCTTGCCTGTGG Chr14:14750988..14751007 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692569 (Chr14:14750958..14751082 +)
Downstram Exon
ENSMUSE00000692568 (Chr14:14754051..14754373 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCTAAAGCTTGCCTGTGG Chr14:14750988..14751007 60.01 55 TTCATGCTTGGATTGGTGAA Chr14:14754359..14754378 60.05 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692569 Chr14:14750958..14751082 CTCCTAAAGCTTGCCTGTGG Chr14:14750988..14751007 60.01 55

*** Putative Vector Insertion (Chr 14: 14751083 - 14754050) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692568 Chr14:14754051..14754373 TTCATGCTTGGATTGGTGAA Chr14:14754359..14754378 60.05 40
downstream ENSMUSE00000692567 Chr14:14776065..14776189 ATCGCTTGGTGGTTCTCTTG Chr14:14776157..14776176 60.26 50
downstream ENSMUSE00000692566 Chr14:14780306..14780419 CATGCTCCGCTTCTTCTTTT Chr14:14780371..14780390 59.59 45
downstream ENSMUSE00000692564 Chr14:14780809..14782072 ATGGCGTTTGGGATACACAT Chr14:14781456..14781475 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTAATCGCCTTGCAGCACA Chr14:14751050..14751070 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTCATTCAAAGGGAAGGT Chr14:14751055..14751075 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079357