Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31887
Trapped Gene
Abcd1 (ENSMUSG00000031378)
Vector Insertion
Chr X: 70966434 - 70974322
Public Clones IST14906H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000208803 (ChrX:70966253..70966433 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGCTGTCCCCATCATCACA ChrX:70966392..70966411 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000208803 (ChrX:70966253..70966433 +)
Downstram Exon
ENSMUSE00000208813 (ChrX:70974323..70974465 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGCTGTCCCCATCATCACA ChrX:70966392..70966411 60.07 50 CGCTCACTAACCAGCTCCTC ChrX:70974386..70974405 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699444 ChrX:70961936..70963269 TTCTAACCCAACCGATCCAG ChrX:70962176..70962195 59.93 50
upstream ENSMUSE00000344463 ChrX:70962107..70963269 TTCTAACCCAACCGATCCAG ChrX:70962176..70962195 59.93 50
upstream ENSMUSE00000208803 ChrX:70966253..70966433 TAGCTGTCCCCATCATCACA ChrX:70966392..70966411 60.07 50

*** Putative Vector Insertion (Chr X: 70966434 - 70974322) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000208813 ChrX:70974323..70974465 CGCTCACTAACCAGCTCCTC ChrX:70974386..70974405 60.16 60
downstream ENSMUSE00000208796 ChrX:70974548..70974716 CCCCTCTACATGGACACCAG ChrX:70974703..70974722 60.38 60
downstream ENSMUSE00000208815 ChrX:70976133..70976227 TGGGTGTGATGATAGGGATG ChrX:70976195..70976214 59.17 50
downstream ENSMUSE00000699443 ChrX:70976133..70976771 TCAGCTTCACCTTGGCCTAT ChrX:70976418..70976437 59.84 50
downstream ENSMUSE00000208795 ChrX:70979348..70979493 TCCACCTAGGATTCGGAACA ChrX:70979428..70979447 60.45 50
downstream ENSMUSE00000208817 ChrX:70979801..70979946 CGCAGAGTCGGGATAGATCA ChrX:70979858..70979877 61.31 55
downstream ENSMUSE00000208811 ChrX:70982129..70982213 CCAATCCTCTGCTTCTCACC ChrX:70982192..70982211 59.8 55
downstream ENSMUSE00000208798 ChrX:70982442..70982567 ATCTTTGGCTGCTTGGAAGA ChrX:70982526..70982545 59.96 45
downstream ENSMUSE00000362611 ChrX:70982651..70983869 CACAATGGCAGTAGGGTGTG ChrX:70983799..70983818 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACAATGTTTAATCGCCTTG ChrX:70972475..70972496 60.36 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCACAATGTTCGTGACTGG ChrX:70972474..70972494 60.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031378