Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31902
Trapped Gene
Zfy1 (ENSMUSG00000053211)
Vector Insertion
Chr Y: 96292 - 133620
Public Clones (sanger) IST13415B4 (tigm) IST12179G10 (tigm) IST13333A9 (tigm) IST13415B4 (tigm)
IST14752G8 (tigm) IST14508H10 (tigm) IST12607B12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000448971 (ChrY:133554..133619 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGTCGTCATTGCCTACCC ChrY:133569..133588 60.52 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000448971 (ChrY:133554..133619 -)
Downstram Exon
ENSMUSE00000434270 (ChrY:96293..96380 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGTCGTCATTGCCTACCC ChrY:133569..133588 60.52 55 CTTCATCCATGGCCTTCAGT ChrY:96322..96341 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448975 ChrY:133718..133852 GAACGGAAAGACTGGTGAGC ChrY:133778..133797 59.85 55
upstream ENSMUSE00000448971 ChrY:133554..133619 CTTGTCGTCATTGCCTACCC ChrY:133569..133588 60.52 55
upstream ENSMUSE00000434270 ChrY:96293..96380 AGGCCATGGATGAAGATGAA ChrY:96339..96358 60.43 45

*** Putative Vector Insertion (Chr Y: 96292 - 133620) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568766 ChrY:75035..75586 GGCATCCCACTGGAATCTAA ChrY:75069..75088 59.89 50
downstream ENSMUSE00000568762 ChrY:71462..71611 TGCTTTGCTAGGTTCATCCA ChrY:71570..71589 59.42 45
downstream ENSMUSE00000568758 ChrY:69371..69511 ACTCTGGGAACACGAATGCT ChrY:69399..69418 59.73 50
downstream ENSMUSE00000568756 ChrY:66057..66179 CATCCATCTGTTGCTCATGC ChrY:66086..66105 60.23 50
downstream ENSMUSE00000568754 ChrY:63952..64092 CAAGGCCACCAGACTCATCT ChrY:63993..64012 60.26 55
downstream ENSMUSE00000476086 ChrY:61650..63038 GCCTTTGTGTGAACGGAAAT ChrY:62275..62294 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTAATCGCCTTGCAGCACA ChrY:97551..97571 62.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTAGAAATCGTGACTGGGAAAA ChrY:121555..121578 59.65 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053211