Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31908
Trapped Gene
Bbs1 (ENSMUSG00000006464)
Vector Insertion
Chr 19: 4897279 - 4897695
Public Clones IST14619D10 (tigm) IST12016E2 (tigm) IST13791B4 (tigm) IST10536G9 (tigm)
IST11997B3 (tigm) IST13957A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000146181 (Chr19:4897574..4897694 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000146181 (Chr19:4897574..4897694 -)
Downstram Exon
ENSMUSE00000442072 (Chr19:4897280..4897438 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000553649 Chr19:4906556..4906616 No primer for this exon
upstream ENSMUSE00000553646 Chr19:4906142..4906218 No primer for this exon
upstream ENSMUSE00000622599 Chr19:4905985..4906019 No primer for this exon
upstream ENSMUSE00000485347 Chr19:4903702..4903974 No primer for this exon
upstream ENSMUSE00000622598 Chr19:4903146..4903192 No primer for this exon
upstream ENSMUSE00000146150 Chr19:4903014..4903052 No primer for this exon
upstream ENSMUSE00000146162 Chr19:4902843..4902915 No primer for this exon
upstream ENSMUSE00000359659 Chr19:4900491..4900622 No primer for this exon
upstream ENSMUSE00000146170 Chr19:4899200..4899306 No primer for this exon
upstream ENSMUSE00000146181 Chr19:4897574..4897694 No primer for this exon
upstream ENSMUSE00000442072 Chr19:4897280..4897438 No primer for this exon

*** Putative Vector Insertion (Chr 19: 4897279 - 4897695) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000146185 Chr19:4894962..4895031 No primer for this exon
downstream ENSMUSE00000146166 Chr19:4894261..4894419 No primer for this exon
downstream ENSMUSE00000146148 Chr19:4892888..4893021 No primer for this exon
downstream ENSMUSE00000146155 Chr19:4891653..4891787 No primer for this exon
downstream ENSMUSE00000146176 Chr19:4890990..4891076 No primer for this exon
downstream ENSMUSE00000553616 Chr19:4886898..4890758 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGCCCAGCCAGTGTAATC Chr19:4897639..4897659 60.14 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACACCCCAAGTACTGCATCG Chr19:4897664..4897684 60.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006464