Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31916
Trapped Gene
Ntrk3 (ENSMUSG00000059146)
Vector Insertion
Chr 7: 85500912 - 85595876
Public Clones IST10079G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000322271 (Chr7:85595773..85595875 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTCCTTCTGGTGGTTCTCT Chr7:85595821..85595840 59.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000322271 (Chr7:85595773..85595875 -)
Downstram Exon
ENSMUSE00000449541 (Chr7:85500913..85501101 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTCCTTCTGGTGGTTCTCT Chr7:85595821..85595840 59.3 55 AATTGTGACCCTGACGGAAG Chr7:85500909..85500928 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000449596 Chr7:85722422..85722861 AGCGTCTGGCTGGACTATGT Chr7:85722593..85722612 59.9 55
upstream ENSMUSE00000322218 Chr7:85662305..85662379 CTACACGGGACTCCAGAAGC Chr7:85662306..85662325 59.87 60
upstream ENSMUSE00000149581 Chr7:85661615..85661686 AGAACCCCCACTTGCGTTAT Chr7:85661617..85661636 60.74 50
upstream ENSMUSE00000149556 Chr7:85622750..85622818 AAGTAACCGGCTCACCACAC Chr7:85622790..85622809 60.03 55
upstream ENSMUSE00000322284 Chr7:85607671..85607828 CCGCATGAACATCAGTCAGT Chr7:85607674..85607693 59.71 50
upstream ENSMUSE00000149575 Chr7:85606472..85606614 CCTGACTGTCCGAGAAGGAG Chr7:85606564..85606583 59.98 60
upstream ENSMUSE00000149579 Chr7:85605931..85606072 GCCAGTGTTGCTCTCACTGT Chr7:85605936..85605955 59.05 55
upstream ENSMUSE00000149561 Chr7:85605167..85605463 CTGAGGTACGCCTGGAACAT Chr7:85605414..85605433 60.13 55
upstream ENSMUSE00000470073 Chr7:85598209..85598232 No primer for this exon
upstream ENSMUSE00000149573 Chr7:85596777..85596841 CACTGTGACCCACAAACCAG Chr7:85596794..85596813 60.04 55
upstream ENSMUSE00000322271 Chr7:85595773..85595875 CGTCCTTCTGGTGGTTCTCT Chr7:85595821..85595840 59.3 55
upstream ENSMUSE00000449541 Chr7:85500913..85501101 ACCATGGCATCACTACACCA Chr7:85501025..85501044 59.84 50

*** Putative Vector Insertion (Chr 7: 85500912 - 85595876) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000322191 Chr7:85449178..85449312 GACACATCCCCACTCTGGAC Chr7:85449173..85449192 60.38 60
downstream ENSMUSE00000371243 Chr7:85447515..85447633 AAAAGCCATGACGTCCTTTG Chr7:85447495..85447514 60.11 45
downstream ENSMUSE00000322316 Chr7:85405170..85405300 CTTGTCTTTGGTGGGGCTTA Chr7:85405166..85405185 60.1 50
downstream ENSMUSE00000322313 Chr7:85395587..85395759 CATCACCACACACCCCATAG Chr7:85395626..85395645 59.68 55
downstream ENSMUSE00000322309 Chr7:85392041..85392284 CAGGTCCCGGTGTACAAAGT Chr7:85392112..85392131 59.88 55
downstream ENSMUSE00000530585 Chr7:85343679..85343837 TGTGGTGAACTTCCGGTACA Chr7:85343744..85343763 60 50
downstream ENSMUSE00000365509 Chr7:85337445..85337630 CTGGGTCTCTCCAAGACACG Chr7:85337565..85337584 60.85 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCACCCTCATTTAGCTCTG Chr7:85547867..85547887 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCACCCTCATTTAGCTCTG Chr7:85547867..85547887 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059146