Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31920
Trapped Gene
Arih2 (ENSMUSG00000064145)
Vector Insertion
Chr 9: 108505277 - 108507749
Public Clones IST12755G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000511248 (Chr9:108507665..108507748 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAAGTTGAGCGTGCAGACA Chr9:108507679..108507698 60.18 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000511248 (Chr9:108507665..108507748 -)
Downstram Exon
ENSMUSE00000370226 (Chr9:108505278..108507484 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAAGTTGAGCGTGCAGACA Chr9:108507679..108507698 60.18 50 CCACAGCCCAGTTTAGGTGT Chr9:108507379..108507398 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000516014 Chr9:108551560..108551711 GTCAGCCTGGTTTGGTCTGG Chr9:108551613..108551632 63.01 60
upstream ENSMUSE00000512727 Chr9:108547264..108547325 TGGGTGATATCTGCAGGAAAG Chr9:108547281..108547301 60.08 47.62
upstream ENSMUSE00000221357 Chr9:108546357..108546699 GTAGCCAGTGATGTGGAGCA Chr9:108546469..108546488 59.86 55
upstream ENSMUSE00000221350 Chr9:108522390..108522457 TTTCCACTGGCAAGTCTCAG Chr9:108522403..108522422 59.01 50
upstream ENSMUSE00000221358 Chr9:108519703..108519766 TTGAGGCTCGAGTTCAACCTA Chr9:108519717..108519737 60 47.62
upstream ENSMUSE00000221365 Chr9:108519009..108519159 TGTGCGGAAGGAAAACCTAC Chr9:108519093..108519112 60.11 50
upstream ENSMUSE00000221361 Chr9:108517356..108517477 TGTCCACTTCGAACACCAGA Chr9:108517435..108517454 60.28 50
upstream ENSMUSE00000221353 Chr9:108516057..108516166 CATGGTTATCCGGGTACAGG Chr9:108516106..108516125 60.07 55
upstream ENSMUSE00000221363 Chr9:108513964..108514081 TCACCAAGTGTGCAGACGAC Chr9:108514003..108514022 60.95 55
upstream ENSMUSE00000221364 Chr9:108512228..108512278 TCTGCATCGAGAAGAATGGA Chr9:108512243..108512262 59.48 45
upstream ENSMUSE00000221351 Chr9:108512109..108512130 No primer for this exon
upstream ENSMUSE00000221352 Chr9:108510933..108511084 TGGAAGACGCATGGTAGTGA Chr9:108511039..108511058 60.26 50
upstream ENSMUSE00000221355 Chr9:108510240..108510383 GAGCGGATTCACGAGAAGAT Chr9:108510319..108510338 59.39 50
upstream ENSMUSE00000221362 Chr9:108509619..108509687 No primer for this exon
upstream ENSMUSE00000511248 Chr9:108507665..108507748 GAAAGTTGAGCGTGCAGACA Chr9:108507679..108507698 60.18 50
upstream ENSMUSE00000370226 Chr9:108505278..108507484 ACCCTCAGTGGTTGTCCTTG Chr9:108505463..108505482 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000064145