Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31928
Trapped Gene
D0Kist4 (ENSMUSG00000078690)
Vector Insertion
Chr 7: 68326484 - 68339926
Public Clones (sanger) IST11845E4 (tigm) IST14502A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673499 (Chr7:68339873..68339925 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTGTCTCCTTGCCAATAAA Chr7:68339901..68339921 59.69 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673499 (Chr7:68339873..68339925 -)
Downstram Exon
ENSMUSE00000673498 (Chr7:68326485..68326588 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTGTCTCCTTGCCAATAAA Chr7:68339901..68339921 59.69 42.86 TTGGGAATTTTCCCTGATTTT Chr7:68326526..68326546 59.65 33.33

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673502 Chr7:68366627..68366851 GCTTGTACGAGGCTCTTGCT Chr7:68366716..68366735 59.79 55
upstream ENSMUSE00000366861 Chr7:68347493..68347875 CGACAACAGCAAGAGGAACA Chr7:68347829..68347848 60.03 50
upstream ENSMUSE00000673501 Chr7:68347112..68347152 No primer for this exon
upstream ENSMUSE00000673500 Chr7:68342631..68342739 AACCCATGCTTCCTCTCAAC Chr7:68342678..68342697 59.14 50
upstream ENSMUSE00000673499 Chr7:68339873..68339925 TCCTGTCTCCTTGCCAATAAA Chr7:68339901..68339921 59.69 42.86
upstream ENSMUSE00000673498 Chr7:68326485..68326588 No primer for this exon

*** Putative Vector Insertion (Chr 7: 68326484 - 68339926) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673497 Chr7:68322314..68322416 GAGGTCAATGCCAAAGGTGT Chr7:68322303..68322322 59.97 50
downstream ENSMUSE00000673496 Chr7:68296114..68296235 CCCAGTAAAATCTGGCACAA Chr7:68296140..68296159 58.62 45
downstream ENSMUSE00000673494 Chr7:68279151..68279477 CTCCTACGTTGCTGTTGCTG Chr7:68279277..68279296 59.66 55
downstream ENSMUSE00000673493 Chr7:68278821..68278861 No primer for this exon
downstream ENSMUSE00000673492 Chr7:68275836..68275944 TCATGAAGCTGAGATGAAGCA Chr7:68275854..68275874 59.69 42.86
downstream ENSMUSE00000673491 Chr7:68274657..68274831 ACTCCTCAGGCATTGCATCT Chr7:68274641..68274660 59.83 50
downstream ENSMUSE00000673490 Chr7:68261745..68261845 No primer for this exon
downstream ENSMUSE00000673489 Chr7:68247638..68247706 No primer for this exon
downstream ENSMUSE00000673488 Chr7:68234469..68235994 TGCTGCAATGAGGATTCAAG Chr7:68235009..68235028 59.95 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATCTTCCCGTGACAGACCA Chr7:68339937..68339957 60.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTTCCCGTGACAGACCAC Chr7:68339936..68339956 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078690