Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31944
Trapped Gene
Odz2 (ENSMUSG00000049336)
Vector Insertion
Chr 11: 36757442 - 36959143
Public Clones IST10978H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662654 (Chr11:36959030..36959142 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGAGCACTCCCAGAAACG Chr11:36959064..36959083 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662654 (Chr11:36959030..36959142 -)
Downstram Exon
ENSMUSE00000662653 (Chr11:36757443..36757743 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGAGCACTCCCAGAAACG Chr11:36959064..36959083 60.44 55 GGTCTCGCTGGAACTGTAGG Chr11:36757512..36757531 59.87 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662655 Chr11:37049339..37049384 AGCTACTGACCGAGCTGCTG Chr11:37049339..37049358 60.9 60
upstream ENSMUSE00000662654 Chr11:36959030..36959142 AGTGAGCACTCCCAGAAACG Chr11:36959064..36959083 60.44 55
upstream ENSMUSE00000486747 Chr11:36757443..36757668 CCTACAGTTCCAGCGAGACC Chr11:36757534..36757553 59.87 60
upstream ENSMUSE00000662653 Chr11:36757443..36757743 CCTACAGTTCCAGCGAGACC Chr11:36757534..36757553 59.87 60

*** Putative Vector Insertion (Chr 11: 36757442 - 36959143) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471702 Chr11:36678170..36678445 AGGATACCCATGTCGGAACA Chr11:36678342..36678361 60.19 50
downstream ENSMUSE00000465844 Chr11:36198621..36198830 GGGAGGTGTTGCTGTCTAGC Chr11:36198692..36198711 59.87 60
downstream ENSMUSE00000467584 Chr11:36113698..36113932 AGTGTTGACTGGCTGTGGTG Chr11:36113880..36113899 59.78 55
downstream ENSMUSE00000460721 Chr11:36086733..36086971 AAAGGGTATCCCGGAGAAGA Chr11:36086881..36086900 59.9 50
downstream ENSMUSE00000461716 Chr11:36034910..36035032 CCAATTGAGTCCGAGCAGAT Chr11:36034985..36035004 60.22 50
downstream ENSMUSE00000463485 Chr11:36020407..36020612 AACTTCTGCTTCGCCACTGT Chr11:36020541..36020560 60.06 50
downstream ENSMUSE00000476921 Chr11:35984828..35985023 TTGTCCTTGCCGTCATTGTA Chr11:35984838..35984857 60.11 45
downstream ENSMUSE00000352097 Chr11:35977221..35977322 CACAGTCCAGACACGCATTC Chr11:35977240..35977259 60.32 55
downstream ENSMUSE00000102334 Chr11:35960517..35960711 TTCATAGGCACATCGCACTC Chr11:35960590..35960609 59.83 50
downstream ENSMUSE00000102352 Chr11:35954985..35955185 AGCAGGTAGGATCCAAGCAA Chr11:35955140..35955159 59.84 50
downstream ENSMUSE00000102360 Chr11:35953078..35953263 TCTTTACAGGTCCCGTGCTC Chr11:35953106..35953125 60.26 55
downstream ENSMUSE00000662652 Chr11:35953078..35953260 TCTTTACAGGTCCCGTGCTC Chr11:35953106..35953125 60.26 55
downstream ENSMUSE00000580252 Chr11:35920221..35920367 AGTGTGCATCTCCCGTTACC Chr11:35920303..35920322 60 55
downstream ENSMUSE00000267908 Chr11:35891862..35892072 CCTTGCTGAATGATGTCCAA Chr11:35891945..35891964 59.65 45
downstream ENSMUSE00000484911 Chr11:35886232..35886351 AGACACATTCACACCCACCA Chr11:35886260..35886279 59.85 50
downstream ENSMUSE00000580251 Chr11:35882866..35883127 GGCTCGCTCAAAGTGAAGAG Chr11:35883051..35883070 60.28 55
downstream ENSMUSE00000486643 Chr11:35881820..35882087 TGATCTTCAGCAGCGACTTG Chr11:35881972..35881991 60.29 50
downstream ENSMUSE00000480051 Chr11:35877279..35877422 TCACATTGAGGGTGTGGTGT Chr11:35877263..35877282 59.85 50
downstream ENSMUSE00000480942 Chr11:35876591..35876840 AGATGCGCCGGATATAGTTG Chr11:35876606..35876625 60.08 50
downstream ENSMUSE00000493139 Chr11:35868428..35868448 No primer for this exon
downstream ENSMUSE00000518039 Chr11:35865292..35865524 GCTCCGCTCAGAGACTTGAC Chr11:35865392..35865411 60.29 60
downstream ENSMUSE00000580250 Chr11:35862594..35862748 TGCTCGAGTCACAGCTCAGT Chr11:35862586..35862605 59.92 55
downstream ENSMUSE00000521237 Chr11:35860269..35861143 TCTCGTCCGTCTCAGTGATG Chr11:35860869..35860888 59.98 55
downstream ENSMUSE00000514494 Chr11:35855011..35855186 CCGGTTGGAGTTCTCAATGT Chr11:35855053..35855072 59.97 50
downstream ENSMUSE00000515485 Chr11:35853209..35853444 TGGTAGCTGTTTCGCACTTG Chr11:35853401..35853420 60.05 50
downstream ENSMUSE00000500895 Chr11:35840647..35840943 TTCTCCGTTCGGATATTTCG Chr11:35840866..35840885 60.03 45
downstream ENSMUSE00000501935 Chr11:35836806..35838420 CTTGCCGGAAATCTCATCAT Chr11:35837841..35837860 60.04 45
downstream ENSMUSE00000494973 Chr11:35823877..35824007 TCGCTTGCTTGACTCTCTGA Chr11:35823865..35823884 60.01 50
downstream ENSMUSE00000715455 Chr11:35821537..35822298 ATGGTGGTTCCTAGCGTGAC Chr11:35821927..35821946 60 55
downstream ENSMUSE00000717546 Chr11:35821537..35822298 ATGGTGGTTCCTAGCGTGAC Chr11:35821927..35821946 60 55
downstream ENSMUSE00000662651 Chr11:35820158..35822298 ATGGTGGTTCCTAGCGTGAC Chr11:35821927..35821946 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTATCTCGACTTGCGGTGAAG Chr11:36881166..36881187 59.89 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTATCTCGACTTGCGGTGAAG Chr11:36881166..36881187 59.89 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049336