Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31956
Trapped Gene
Pole (ENSMUSG00000007080)
Vector Insertion
Chr 5: 110747779 - 110752556
Public Clones IST14264B9 (tigm) IST12672D8 (tigm) IST14440H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000298105 (Chr5:110747635..110747778 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000298105 (Chr5:110747635..110747778 +)
Downstram Exon
ENSMUSE00000298098 (Chr5:110752557..110752697 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691823 Chr5:110715360..110715468 No primer for this exon
upstream ENSMUSE00000369900 Chr5:110715403..110715468 No primer for this exon
upstream ENSMUSE00000298361 Chr5:110718252..110718393 No primer for this exon
upstream ENSMUSE00000298348 Chr5:110718801..110718881 No primer for this exon
upstream ENSMUSE00000298335 Chr5:110719245..110719289 No primer for this exon
upstream ENSMUSE00000298326 Chr5:110719424..110719516 No primer for this exon
upstream ENSMUSE00000298315 Chr5:110719978..110720132 No primer for this exon
upstream ENSMUSE00000691821 Chr5:110719978..110720254 No primer for this exon
upstream ENSMUSE00000298305 Chr5:110722279..110722420 No primer for this exon
upstream ENSMUSE00000298295 Chr5:110722734..110722814 No primer for this exon
upstream ENSMUSE00000298286 Chr5:110723528..110723635 No primer for this exon
upstream ENSMUSE00000298275 Chr5:110723911..110724021 No primer for this exon
upstream ENSMUSE00000298266 Chr5:110724247..110724332 No primer for this exon
upstream ENSMUSE00000298259 Chr5:110724537..110724656 No primer for this exon
upstream ENSMUSE00000298248 Chr5:110726025..110726157 No primer for this exon
upstream ENSMUSE00000298235 Chr5:110726367..110726480 No primer for this exon
upstream ENSMUSE00000298229 Chr5:110726752..110726964 No primer for this exon
upstream ENSMUSE00000298224 Chr5:110727260..110727367 No primer for this exon
upstream ENSMUSE00000298220 Chr5:110727911..110728039 No primer for this exon
upstream ENSMUSE00000298213 Chr5:110728119..110728221 No primer for this exon
upstream ENSMUSE00000298205 Chr5:110728308..110728454 No primer for this exon
upstream ENSMUSE00000298200 Chr5:110728792..110728937 No primer for this exon
upstream ENSMUSE00000298194 Chr5:110731027..110731175 No primer for this exon
upstream ENSMUSE00000298187 Chr5:110732594..110732686 No primer for this exon
upstream ENSMUSE00000298181 Chr5:110732874..110733018 No primer for this exon
upstream ENSMUSE00000298175 Chr5:110735346..110735503 No primer for this exon
upstream ENSMUSE00000298169 Chr5:110735786..110735981 No primer for this exon
upstream ENSMUSE00000298158 Chr5:110737955..110738169 No primer for this exon
upstream ENSMUSE00000298146 Chr5:110741026..110741128 No primer for this exon
upstream ENSMUSE00000298139 Chr5:110741753..110741833 No primer for this exon
upstream ENSMUSE00000298132 Chr5:110741925..110742047 No primer for this exon
upstream ENSMUSE00000298120 Chr5:110746809..110747018 No primer for this exon
upstream ENSMUSE00000298113 Chr5:110747245..110747454 No primer for this exon
upstream ENSMUSE00000298105 Chr5:110747635..110747778 No primer for this exon

*** Putative Vector Insertion (Chr 5: 110747779 - 110752556) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000298098 Chr5:110752557..110752697 No primer for this exon
downstream ENSMUSE00000298092 Chr5:110752949..110753102 No primer for this exon
downstream ENSMUSE00000298086 Chr5:110753179..110753285 No primer for this exon
downstream ENSMUSE00000298078 Chr5:110753440..110753616 No primer for this exon
downstream ENSMUSE00000298070 Chr5:110753699..110753922 No primer for this exon
downstream ENSMUSE00000298064 Chr5:110754103..110754323 No primer for this exon
downstream ENSMUSE00000298055 Chr5:110754531..110754735 No primer for this exon
downstream ENSMUSE00000298047 Chr5:110756721..110756894 No primer for this exon
downstream ENSMUSE00000298039 Chr5:110758565..110758690 No primer for this exon
downstream ENSMUSE00000691816 Chr5:110759716..110759853 No primer for this exon
downstream ENSMUSE00000298030 Chr5:110759948..110760089 No primer for this exon
downstream ENSMUSE00000298020 Chr5:110761401..110761578 No primer for this exon
downstream ENSMUSE00000298010 Chr5:110763180..110763311 No primer for this exon
downstream ENSMUSE00000189607 Chr5:110763442..110763635 No primer for this exon
downstream ENSMUSE00000189606 Chr5:110764859..110765059 No primer for this exon
downstream ENSMUSE00000189605 Chr5:110765393..110765518 No primer for this exon
downstream ENSMUSE00000189603 Chr5:110765977..110766066 No primer for this exon
downstream ENSMUSE00000397602 Chr5:110766151..110766472 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACACTGGCCTCTGTTGCTA Chr5:110750787..110750807 59.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACTGGCCTCTGTTGCTA Chr5:110750787..110750807 59.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007080