Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31957
Trapped Gene
Cd109 (ENSMUSG00000046186)
Vector Insertion
Chr 9: 78464857 - 78482453
Public Clones IST14440H3 (tigm) IST14899C6 (tigm) IST12672D8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000442787 (Chr9:78464684..78464856 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCGGAGCAAATGTGACTAT Chr9:78464721..78464740 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000442787 (Chr9:78464684..78464856 +)
Downstram Exon
ENSMUSE00000442784 (Chr9:78482454..78482482 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCGGAGCAAATGTGACTAT Chr9:78464721..78464740 59.96 50 GCCGGAAGAACGAGAGTCTT Chr9:78482484..78482503 60.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000442816 Chr9:78463584..78463759 CCCACCTTCTCTGCTTGTGC Chr9:78463717..78463736 63.27 60
upstream ENSMUSE00000442787 Chr9:78464684..78464856 CCCGGAGCAAATGTGACTAT Chr9:78464721..78464740 59.96 50

*** Putative Vector Insertion (Chr 9: 78464857 - 78482453) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000442784 Chr9:78482454..78482482 GCCGGAAGAACGAGAGTCTT Chr9:78482484..78482503 60.9 55
downstream ENSMUSE00000442780 Chr9:78484256..78484486 AGAGTGTGAGCACCCGAAAC Chr9:78484442..78484461 60.31 55
downstream ENSMUSE00000442776 Chr9:78489786..78489911 TGGAAACGACTCCAAGATCAC Chr9:78489851..78489871 60.1 47.62
downstream ENSMUSE00000375135 Chr9:78502367..78502406 No primer for this exon
downstream ENSMUSE00000332155 Chr9:78505252..78505336 ACGGTGACTTCGAACTTTGG Chr9:78505279..78505298 60.15 50
downstream ENSMUSE00000442760 Chr9:78508070..78508166 TCACTGGCTTCCCGTATGTA Chr9:78508095..78508114 59.15 50
downstream ENSMUSE00000442558 Chr9:78508699..78508858 CTTCCGAGACATCCGTTAGC Chr9:78508786..78508805 59.84 55
downstream ENSMUSE00000442553 Chr9:78509460..78509569 CATTGGTGCTTGCCATTCTT Chr9:78509489..78509508 61.03 45
downstream ENSMUSE00000390357 Chr9:78512010..78512225 GTTATTTTTCCGCTGGGTCA Chr9:78512102..78512121 59.94 45
downstream ENSMUSE00000344326 Chr9:78513251..78513352 No primer for this exon
downstream ENSMUSE00000442535 Chr9:78513443..78513505 No primer for this exon
downstream ENSMUSE00000387986 Chr9:78515046..78515222 GCGATTATACAGGCCTTTGG Chr9:78515149..78515168 59.57 50
downstream ENSMUSE00000362916 Chr9:78517510..78517662 CAGGGAGTCAGACTGTGTCG Chr9:78517596..78517615 59.44 60
downstream ENSMUSE00000405093 Chr9:78519718..78519792 No primer for this exon
downstream ENSMUSE00000343980 Chr9:78520359..78520419 CTGTCAACACCCAGAGACCA Chr9:78520386..78520405 59.71 55
downstream ENSMUSE00000387117 Chr9:78527828..78527969 CAACCAGGTTTGCCTCATTT Chr9:78527887..78527906 59.97 45
downstream ENSMUSE00000346321 Chr9:78528610..78528727 GAGATGACAAAAGCCGAAGC Chr9:78528690..78528709 59.96 50
downstream ENSMUSE00000389482 Chr9:78532642..78532755 AAGGAAAAACGGTTGGAAGG Chr9:78532671..78532690 60.32 45
downstream ENSMUSE00000365784 Chr9:78536537..78536755 TGATGGGAATCTCTCCCAAG Chr9:78536699..78536718 60 50
downstream ENSMUSE00000414134 Chr9:78537516..78537660 GCCAATGACCGTATCAGGAG Chr9:78537635..78537654 60.48 55
downstream ENSMUSE00000367971 Chr9:78538996..78539172 GCATCCGGATCAGTGAAGAT Chr9:78539049..78539068 60.04 50
downstream ENSMUSE00000442480 Chr9:78543627..78543708 GAGTCAATGTCCCCAAAAGC Chr9:78543696..78543715 59.53 50
downstream ENSMUSE00000442461 Chr9:78545890..78546118 TTTTGGTGCCACCTTGAAGT Chr9:78546062..78546081 60.53 45
downstream ENSMUSE00000442802 Chr9:78548002..78548167 TTGTCCGAAATTCCTCTGCT Chr9:78548072..78548091 59.81 45
downstream ENSMUSE00000442829 Chr9:78550843..78551030 GGATTCCCTCAGACACATGG Chr9:78550974..78550993 60.33 55
downstream ENSMUSE00000583862 Chr9:78551460..78551615 TCTGGGAGTCAATTCGGAAG Chr9:78551592..78551611 60.19 50
downstream ENSMUSE00000442786 Chr9:78552845..78552910 ATGGGATCTAGCGCATGAAG Chr9:78552867..78552886 60.2 50
downstream ENSMUSE00000442783 Chr9:78555251..78555390 TGCACACATTCAGATTCAGGT Chr9:78555388..78555408 59.15 42.86
downstream ENSMUSE00000442778 Chr9:78557940..78558087 TCCATAAGGACCATGCCTGT Chr9:78557981..78558000 60.34 50
downstream ENSMUSE00000442774 Chr9:78560344..78560446 No primer for this exon
downstream ENSMUSE00000442813 Chr9:78562699..78564058 GTCACGTGGGCATATGTCAG Chr9:78563622..78563641 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGATCCATCCTGGAAGCAG Chr9:78464820..78464840 59.76 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTTTCGTGACTGGGAAA Chr9:78479901..78479921 60.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046186