Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31963
Trapped Gene
B830045N13Rik (ENSMUSG00000035131)
Vector Insertion
Chr 1: 148362246 - 148529705
Public Clones IST13298E10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689816 (Chr1:148361798..148362245 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGGCTCTATGGGAGTGGA Chr1:148361889..148361908 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689816 (Chr1:148361798..148362245 +)
Downstram Exon
ENSMUSE00000337946 (Chr1:148529706..148529896 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGGCTCTATGGGAGTGGA Chr1:148361889..148361908 60.03 55 GAGTAGGTCGTCGTCCCAAA Chr1:148529830..148529849 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000659140 Chr1:148342796..148343207 TCCTGCAGCTCACCACTCTA Chr1:148343103..148343122 59.73 55
upstream ENSMUSE00000689818 Chr1:148344868..148344982 GGAGCTCTGCCTTCTGTGAG Chr1:148344899..148344918 60.28 60
upstream ENSMUSE00000689817 Chr1:148345893..148345965 GAGCCTTGGTGTGGAGATTC Chr1:148345943..148345962 59.66 55
upstream ENSMUSE00000388671 Chr1:148361798..148362083 GATGGCTCTATGGGAGTGGA Chr1:148361889..148361908 60.03 55
upstream ENSMUSE00000689816 Chr1:148361798..148362245 GATGGCTCTATGGGAGTGGA Chr1:148361889..148361908 60.03 55

*** Putative Vector Insertion (Chr 1: 148362246 - 148529705) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000337946 Chr1:148529706..148529896 GAGTAGGTCGTCGTCCCAAA Chr1:148529830..148529849 60.11 55
downstream ENSMUSE00000381103 Chr1:148548786..148548976 TTCCGCTTGTCCACAAAAAT Chr1:148548825..148548844 60.48 40
downstream ENSMUSE00000332645 Chr1:148593610..148593715 AGAGGACCTGTCCGTGTTTC Chr1:148593638..148593657 59.15 55
downstream ENSMUSE00000378186 Chr1:148598885..148599121 GCAGATAAACTCGCCCTCAG Chr1:148598982..148599001 59.98 55
downstream ENSMUSE00000304502 Chr1:148678691..148678913 GTAGCGGCGCTGAAAATTAG Chr1:148678797..148678816 60.01 50
downstream ENSMUSE00000497815 Chr1:148748131..148749599 CTCCAGGAAGGATCAAACCA Chr1:148748538..148748557 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGTGGAGGGAGTGTATGG Chr1:148449228..148449248 60.38 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTGACTGGGAAAACC Chr1:148449293..148449313 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035131