Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31971
Trapped Gene
Adcy2 (ENSMUSG00000021536)
Vector Insertion
Chr 13: 68873501 - 68877575
Public Clones IST10861F10 (tigm) IST13264B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000381625 (Chr13:68877426..68877574 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000381625 (Chr13:68877426..68877574 -)
Downstram Exon
ENSMUSE00000570376 (Chr13:68873502..68873613 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490398 Chr13:69137952..69138419 No primer for this exon
upstream ENSMUSE00000478683 Chr13:69121225..69121422 No primer for this exon
upstream ENSMUSE00000480742 Chr13:69026837..69026998 No primer for this exon
upstream ENSMUSE00000479770 Chr13:68935408..68935557 No primer for this exon
upstream ENSMUSE00000381625 Chr13:68877426..68877574 No primer for this exon
upstream ENSMUSE00000570376 Chr13:68873502..68873613 No primer for this exon

*** Putative Vector Insertion (Chr 13: 68873501 - 68877575) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000118722 Chr13:68870956..68871083 No primer for this exon
downstream ENSMUSE00000570375 Chr13:68869116..68869274 No primer for this exon
downstream ENSMUSE00000118714 Chr13:68868083..68868215 No primer for this exon
downstream ENSMUSE00000118755 Chr13:68866668..68866844 No primer for this exon
downstream ENSMUSE00000118739 Chr13:68863140..68863183 No primer for this exon
downstream ENSMUSE00000118711 Chr13:68859580..68859660 No primer for this exon
downstream ENSMUSE00000118746 Chr13:68851934..68852003 No primer for this exon
downstream ENSMUSE00000118733 Chr13:68848869..68848966 No primer for this exon
downstream ENSMUSE00000118731 Chr13:68828137..68828221 No primer for this exon
downstream ENSMUSE00000118766 Chr13:68817354..68817491 No primer for this exon
downstream ENSMUSE00000118723 Chr13:68810769..68810888 No primer for this exon
downstream ENSMUSE00000118735 Chr13:68807346..68807515 No primer for this exon
downstream ENSMUSE00000118730 Chr13:68796255..68796339 No primer for this exon
downstream ENSMUSE00000118753 Chr13:68790756..68790914 No primer for this exon
downstream ENSMUSE00000472686 Chr13:68781345..68781491 No primer for this exon
downstream ENSMUSE00000519172 Chr13:68779592..68779699 No primer for this exon
downstream ENSMUSE00000118749 Chr13:68769787..68769901 No primer for this exon
downstream ENSMUSE00000510574 Chr13:68764665..68764789 No primer for this exon
downstream ENSMUSE00000350975 Chr13:68758920..68759749 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTTCTGCTTTCCCTGCTG Chr13:68874549..68874569 60.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGGAAATGACGTGACTG Chr13:68874516..68874536 59.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021536