Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31977
Trapped Gene
Zmat4 (ENSMUSG00000037492)
Vector Insertion
Chr 8: 24780274 - 24858871
Public Clones IST13793F1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000523323 (Chr8:24780135..24780273 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAAGGTCTGGTCGCAGAGA Chr8:24780152..24780171 60.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000523323 (Chr8:24780135..24780273 +)
Downstram Exon
ENSMUSE00000256283 (Chr8:24858872..24858977 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAAGGTCTGGTCGCAGAGA Chr8:24780152..24780171 60.53 55 CCTGATCGATATCGGAGGAC Chr8:24858903..24858922 59.46 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000523323 Chr8:24780135..24780273 GAAAGGTCTGGTCGCAGAGA Chr8:24780152..24780171 60.53 55

*** Putative Vector Insertion (Chr 8: 24780274 - 24858871) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000256283 Chr8:24858872..24858977 CCTGATCGATATCGGAGGAC Chr8:24858903..24858922 59.46 55
downstream ENSMUSE00000256277 Chr8:24907814..24907903 AATACAGCCGGACTTTGCTG Chr8:24907850..24907869 60.27 50
downstream ENSMUSE00000256234 Chr8:25012487..25012643 TTTTAACCTTTTGGCGTGGA Chr8:25012609..25012628 60.46 40
downstream ENSMUSE00000256225 Chr8:25039568..25039795 TCGAGGAGCCTTAAGTGAGC Chr8:25039602..25039621 59.72 55
downstream ENSMUSE00000256212 Chr8:25125588..25125684 AGTTGAGCGACACACTGCAC Chr8:25125638..25125657 60.1 55
downstream ENSMUSE00000523322 Chr8:25170218..25173575 GTTTCCGTGTCGTTTCGTTT Chr8:25171500..25171519 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:24819324..24819344 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCGTCCACCACTGAACTA Chr8:24825289..24825309 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037492