Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31980
Trapped Gene
Gpr177 (ENSMUSG00000028173)
Vector Insertion
Chr 3: 159503012 - 159535872
Public Clones IST14861H12 (tigm) IST14942C9 (tigm) IST14941F10 (tigm) IST14942C11 (tigm)
IST14973H1 (tigm) IST14948H11 (tigm) IST14941B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000269805 (Chr3:159502701..159503011 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGAAGTTTTGCAGCACCA Chr3:159502798..159502817 60.03 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000269805 (Chr3:159502701..159503011 +)
Downstram Exon
ENSMUSE00000560680 (Chr3:159535873..159536145 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGAAGTTTTGCAGCACCA Chr3:159502798..159502817 60.03 45 ATTGCCGTGTAGGGTACTGC Chr3:159535912..159535931 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000269805 Chr3:159502701..159503011 CTTGAAGTTTTGCAGCACCA Chr3:159502798..159502817 60.03 45

*** Putative Vector Insertion (Chr 3: 159503012 - 159535872) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000560680 Chr3:159535873..159536145 ATTGCCGTGTAGGGTACTGC Chr3:159535912..159535931 60.02 55
downstream ENSMUSE00000176987 Chr3:159560295..159560419 CTTTCATGGGCCATTTCAGT Chr3:159560382..159560401 59.93 45
downstream ENSMUSE00000176976 Chr3:159564346..159564507 TCCCCAATTCCAACATTGAT Chr3:159564488..159564507 59.99 40
downstream ENSMUSE00000176980 Chr3:159570079..159570215 CATGGTGATCCTCCTCCAAT Chr3:159570189..159570208 59.74 50
downstream ENSMUSE00000176983 Chr3:159572617..159572785 GCATCCAGGTCCAGTCAAAT Chr3:159572705..159572724 59.93 50
downstream ENSMUSE00000176986 Chr3:159574262..159574359 TGCAATGTGATTCCGTTCAT Chr3:159574291..159574310 59.93 40
downstream ENSMUSE00000486927 Chr3:159574724..159574787 AGCCAGTTCTGTTCCAACATC Chr3:159574789..159574809 59.2 47.62
downstream ENSMUSE00000176979 Chr3:159576725..159576868 GCAGATACCTGCCACAATGA Chr3:159576757..159576776 59.68 50
downstream ENSMUSE00000176981 Chr3:159577900..159577983 CAGCACAAGCCAAGGTGATA Chr3:159577954..159577973 59.86 50
downstream ENSMUSE00000176978 Chr3:159586391..159586544 TGGGATGGTGCATACAAGAA Chr3:159586518..159586537 59.92 45
downstream ENSMUSE00000586064 Chr3:159597215..159598797 TCCAAAGCTGAAATGCCTCT Chr3:159597921..159597940 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAATCGTTGCCTTTCTGGT Chr3:159532979..159532999 60.11 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAATCGTTGCCTTTCTGGT Chr3:159532979..159532999 60.11 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028173