Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31991
Trapped Gene
Snurf (ENSMUSG00000074085)
Vector Insertion
Chr 7: 67140291 - 67144304
Public Clones IST14935E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000402929 (Chr7:67144204..67144303 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCAAACGTCGAAGGACAG Chr7:67144223..67144242 60.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000402929 (Chr7:67144204..67144303 -)
Downstram Exon
ENSMUSE00000364697 (Chr7:67140292..67140440 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCAAACGTCGAAGGACAG Chr7:67144223..67144242 60.69 55 TGAGAACGTCGTGGGTACAA Chr7:67140392..67140411 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673511 Chr7:67144648..67144657 No primer for this exon
upstream ENSMUSE00000402929 Chr7:67144204..67144303 GGTCAAACGTCGAAGGACAG Chr7:67144223..67144242 60.69 55
upstream ENSMUSE00000364697 Chr7:67140292..67140440 TTGTACCCACGACGTTCTCA Chr7:67140414..67140433 60.15 50

*** Putative Vector Insertion (Chr 7: 67140291 - 67144304) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711091 Chr7:67133488..67133633 TTCCACAATAGCCGTTGTCA Chr7:67133477..67133496 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCAGGGATCGCTTACACTTG Chr7:67141282..67141303 60.26 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAGGGATCGCTTACACTTG Chr7:67141282..67141303 60.26 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074085