Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31995
Trapped Gene
Itgb7 (ENSMUSG00000001281)
Vector Insertion
Chr 15: 102054988 - 102058033
Public Clones IST14393F5 (tigm) IST13334C11 (tigm) IST14659H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000284896 (Chr15:102057829..102058032 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000284896 (Chr15:102057829..102058032 -)
Downstram Exon
ENSMUSE00000133153 (Chr15:102054989..102055190 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000284907 Chr15:102062282..102062339 No primer for this exon
upstream ENSMUSE00000284896 Chr15:102057829..102058032 No primer for this exon
upstream ENSMUSE00000133153 Chr15:102054989..102055190 No primer for this exon

*** Putative Vector Insertion (Chr 15: 102054988 - 102058033) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000133162 Chr15:102054733..102054903 No primer for this exon
downstream ENSMUSE00000133165 Chr15:102053762..102054003 No primer for this exon
downstream ENSMUSE00000133159 Chr15:102053072..102053230 No primer for this exon
downstream ENSMUSE00000133157 Chr15:102052773..102052868 No primer for this exon
downstream ENSMUSE00000133155 Chr15:102052520..102052609 No primer for this exon
downstream ENSMUSE00000133160 Chr15:102049605..102049751 No primer for this exon
downstream ENSMUSE00000284830 Chr15:102048928..102049121 No primer for this exon
downstream ENSMUSE00000284820 Chr15:102048205..102048428 No primer for this exon
downstream ENSMUSE00000284808 Chr15:102047678..102047897 No primer for this exon
downstream ENSMUSE00000133158 Chr15:102047323..102047528 No primer for this exon
downstream ENSMUSE00000133161 Chr15:102046903..102047063 No primer for this exon
downstream ENSMUSE00000381055 Chr15:102046429..102046698 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr15:102057967..102057987 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTCCCTGAGGATTTGTGT Chr15:102058055..102058075 61.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001281