Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI320
Trapped Gene
Uhmk1 (ENSMUSG00000026667)
Vector Insertion
Chr 1: 172135335 - 172137244
Public Clones GC0848 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000161736 (Chr1:172137245..172137343 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTGGTGATGCTTCCGACT Chr1:172137309..172137328 59.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000161736 (Chr1:172137245..172137343 -)
Downstram Exon
ENSMUSE00000161734 (Chr1:172135246..172135334 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTGGTGATGCTTCCGACT Chr1:172137309..172137328 59.69 50 TTGTCCTCTGCCAGGATTTT Chr1:172135224..172135243 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000302208 Chr1:172145104..172145524 No primer for this exon
upstream ENSMUSE00000161729 Chr1:172142367..172142659 CTACGTCCATGCAGACCTCA Chr1:172142450..172142469 59.85 55
upstream ENSMUSE00000161739 Chr1:172141162..172141353 GGAGCCTCGGAATCATTTTA Chr1:172141219..172141238 59.12 45
upstream ENSMUSE00000161732 Chr1:172138786..172138880 TTGCCAGTAAAGCAGTGGTG Chr1:172138830..172138849 59.9 50
upstream ENSMUSE00000161738 Chr1:172137477..172137553 GCAGAAGAATCCCTGCTGAG Chr1:172137514..172137533 60.1 55
upstream ENSMUSE00000161736 Chr1:172137245..172137343 ATCTGGTGATGCTTCCGACT Chr1:172137309..172137328 59.69 50

*** Putative Vector Insertion (Chr 1: 172135335 - 172137244) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000161734 Chr1:172135246..172135334 TTGTCCTCTGCCAGGATTTT Chr1:172135224..172135243 59.67 45
downstream ENSMUSE00000593188 Chr1:172129388..172130144 AAATGGGTAAAGGGGTGCTC Chr1:172129882..172129901 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTCAGTGCTTCCCAAGTT Chr1:172137225..172137246 60.16 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTCAGTGCTTCCCAAGTT Chr1:172137225..172137246 60.16 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026667