Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32007
Trapped Gene
Loxl1 (ENSMUSG00000032334)
Vector Insertion
Chr 9: 58145449 - 58159803
Public Clones IST11781B5 (tigm) IST10550F4 (tigm) IST12064C1 (tigm) IST14667G8 (tigm)
IST10551F9 (tigm) IST11020C7 (tigm) IST13030B2 (tigm) IST14830C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000455924 (Chr9:58159493..58159802 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCAGCGTGGGTAGTGTGT Chr9:58159517..58159536 59.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000455924 (Chr9:58159493..58159802 -)
Downstram Exon
ENSMUSE00000636459 (Chr9:58145450..58145536 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCAGCGTGGGTAGTGTGT Chr9:58159517..58159536 59.34 55 ATGCCTGCACGTAGTTAGGG Chr9:58145473..58145492 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455940 Chr9:58160004..58160693 GACCTACGAACAGGGCTACG Chr9:58160084..58160103 59.76 60
upstream ENSMUSE00000500954 Chr9:58159870..58160001 GGACTACGGAGGTGGAGGAG Chr9:58159967..58159986 61.04 65
upstream ENSMUSE00000455928 Chr9:58159805..58159867 CGCACAGCCTGTACAATGAA Chr9:58159809..58159828 60.87 50
upstream ENSMUSE00000455924 Chr9:58159493..58159802 TCTCAGCGTGGGTAGTGTGT Chr9:58159517..58159536 59.34 55
upstream ENSMUSE00000500095 Chr9:58159493..58160993 GACCTACGAACAGGGCTACG Chr9:58160084..58160103 59.76 60
upstream ENSMUSE00000636459 Chr9:58145450..58145536 AGTCCCGGACCCTAACTACG Chr9:58145504..58145523 60.37 60

*** Putative Vector Insertion (Chr 9: 58145449 - 58159803) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000534028 Chr9:58145428..58145536 ATGCCTGCACGTAGTTAGGG Chr9:58145473..58145492 60.15 55
downstream ENSMUSE00000345065 Chr9:58142166..58142303 CGGAGGTCATAGTCGGTAGC Chr9:58142243..58142262 59.72 60
downstream ENSMUSE00000455919 Chr9:58141469..58141524 GATGCATCAAGCAGGTCGTA Chr9:58141464..58141483 59.83 50
downstream ENSMUSE00000534027 Chr9:58141380..58141536 GATGCATCAAGCAGGTCGTA Chr9:58141464..58141483 59.83 50
downstream ENSMUSE00000534026 Chr9:58140376..58140471 TGTCCGCATTGTATGTGTCA Chr9:58140410..58140429 59.54 45
downstream ENSMUSE00000455907 Chr9:58138562..58138677 CACCACGTTGTTGGTGAAGT Chr9:58138599..58138618 59.49 50
downstream ENSMUSE00000584308 Chr9:58136409..58136724 CAATCTTGCTGTGTGGGATG Chr9:58136424..58136443 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACACTGAGTGCCTCCAATCC Chr9:58156766..58156786 60.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACACTGAGTGCCTCCAATCC Chr9:58156766..58156786 60.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032334